Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.3   

sjj_F22D6.3 RNAi JA:F22D6.3
Simmer:F22D6.3:Screen_A
Simmer:F22D6.3:Screen_B
PCR_productsjj_F22D6.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F22D6.3 Source_evidenceePCR1048WS150 Sequence/Annotation Release
Chunk_score Abs_score964
Max_abs_score964F22D6.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70881047089293
Overlaps_transcript F22D6.3a.1 Source_evidenceePCR1048WS150 Sequence/Annotation Release
F22D6.3a.2 Source_evidenceePCR963WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.31190cagataaggccaatcggtgtaagcttggctgaaacggggaacaaaaaaaccaataggcaatagaatatggggaaaatagatcagtttacggagcacatctgccgacaaatctcgggtacaaacagacgtcgcggatgtggttggtgtcggtcaaccagcagatgaaacgctccagtcccaatccatatccaccatgtggtacacttccgtatttccgttgatccatgtaccagtaatagtttttagagtcaagtcctcctttctcaaatgcagccaacaactgatcttccttccagatacgcattgatcctccaacgatttctccaactcctggcatcaaaagatctacggactcggtcaactcgttatcgtctgcacagcgtggcatgtagaaggctttgattccatgtgggaaacggttgagaagaattggctgaaatgaacaatacagttagataaaaataaaaggaacactcaccactccaatggtatcagtcattcttctctcagcagcttcagcaatatcttcaccgtacacaaacttttctcccatctcgttgcgaacatcattcttctgaagccattcgattgcttccttgtatggcattctcttgaatggtcgggctggtgccttatatccctaaaattacagatattaaaatgattttatgtataataaaccaaccgggttcacgaactcgatcaacgatttggtgactggatctgcaagaagccgatcaacagtatcacaaacaagagcctcaatgcgatccataagttgatcgaaagtgataaaagcgcattcagcctcaacgtgttgatactctgacagatggcgacgagttctcgatttttcggctctgaaatttatttttgaatactagtgttctaaaaaaatgtcaaaaaacctacctgtacgactgtgaaatacaataaacatcaccaagagcagcattgcaagtctccaaataaagttgagaagattgtgtcaagtatgcaggctctccataataatcaagcccaaagagagtggaaccaccctcaacttgtgtttgcaccaaagttggaggagcaacttcagtatatccagcagcaaagaaatgatctctcattgcacgagtagctgcagcgcgaatacgaagaattcttgatgcattctctccacggatgacaaggtggcggttatcaag