Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.4   

sjj_F22D6.4 RNAi JA:F22D6.4
Simmer:F22D6.4:Screen_A
Simmer:F22D6.4:Screen_B
PCR_productsjj_F22D6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F22D6.4 Source_evidenceePCR434WS150 Sequence/Annotation Release
Chunk_score Abs_score371
Max_abs_score371F22D6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70902287091259
Overlaps_transcript F22D6.4.2 Source_evidenceePCR428WS150 Sequence/Annotation Release
F22D6.4.1 Source_evidenceePCR434WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.41032aattgggaaaatctgacgaaaattccaacaaaagtgagattgtgcaatcgcacgaaactgtcgtcaagttcagtgtttgcgtactcccctgtcttaactcttactttaaatttatgcctccctagctgaaaatcaaatcaattttagacaatcttagaataaacatgtatcctatttaaaatttgacgggtcaaattaatttattcgttcacaaatcactcagaaaacgatgtggaagattcattacggtgcacaatggtaattcgtgtttttgacgcaagcatttcatttgacgccaagttgcgggcgttgagaaacatctttttaattgacgtcaaatttgtttgaaaacagatgattaacaacaatttgtctagtttaagtataaaacaatgtttgttcatgttttataaagaaggaaattgttacggtttttacaattatttcttcgttgctcttttatattgaattcaaagttgtatcgattaatcataatcactgtttggtttagtaatgaaccggcttcttcaacagtcggtttcacgcggacctcttgccgtccgagcttcttctacaattacaacaaagccaccaactccgaatcaaattaccaaaaacaatgcacaattcgacaaggtgactcacaccggacaagtaagtgtttcttatataacttttcaaataaaataagcacattttcaggcgtgggatcaatctgattatcgtcttcaaagatttgatatttcgaagaaaagcgtcaatccaaatgtagcaatgcatcttattgatcaacgccctccagaggattgcggggataagagagttgtcttctgtgatggaggacatccagctcttggacatccgaaagtatacatcaaccttgttagtttttttttaacttttaatgtcacactttaattttttcaggacaaaccaggagttcatgcttgcggatattgtggaaaccgattctataactcgcacgccacgaaggcagaggacatgaagatccaacacctcaactgctaattt