Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.5   

sjj_F22D6.5 RNAi JA:F22D6.5
Simmer:F22D6.5:Repeat_b
Simmer:F22D6.5:Screen_A
Simmer:F22D6.5:Screen_B
PCR_productsjj_F22D6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22D6.5 Source_evidenceePCR720WS150 Sequence/Annotation Release
Overlaps_Gene F22D6.5 (3)
Overlaps_transcriptF22D6.5 Source_evidenceePCR741WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.5964tcttgccgcttcaattttcttctgttcatcatcagaatcagaatccaaattccactcaacatcctttgactcatcttttctcttcccatcctctctttttctatccgagtcacgtcttctatcaggacttcttctatgacgatcctctcttcttccatctctgtcacgacgatctctgttgtttctgaatctttctggtgttctatctctacgacgatttccttcatgagcacgcggatctcttctgttatcttctctttttctctgaatcaatcttcgttctttactaagtgatcgatctcttcgttcagcatctcgtctttctcgcaattcacgatccctacgttcagcactttttgagcgttcccttctaggaggatttctgagttcatcttcattgtttcgagatgattcttttgcttctttctttttagattcgtcttttttagtatcgacttcttctaaagttctcttttttgctggaggaccatcattttccatttcaacttctttttcgcgtttatgttttttctccttcttatgcttcttatcctttttgtgttttttctctttcttatgcttcttctttttatctgtaaataaaactaattatttgaaacaatttaatattctcaccttttccagatctttccgaatcagtcctttgtctcttctcaacctcggaatccgatgccttctcatctgaagacgttccaacatcggatttcacttccccatcctcttcaacacgattgtcctccatttcgatactcgatcaccggcgtttttctgaaaattttcaaattgagattcacatgttctgccgctttcctcatgcacactttcaacccccagcctaactgagccgcaagcgagaaaatattttcagctgataccgggtcacaagatgacgtttcctcataaacttcttggagagtggcggaagaaggtgcgcaaaagacat