Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.5   

sjj_F22D6.5 RNAi (4)
PCR_productsjj_F22D6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22D6.5 Source_evidenceePCR720WS150 Sequence/Annotation Release
Overlaps_Gene F22D6.5 Source_evidenceePCR741WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678F22D6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70937487094711
Overlaps_transcriptF22D6.5 Source_evidenceePCR741WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.5964tcttgccgcttcaattttcttctgttcatcatcagaatcagaatccaaattccactcaacatcctttgactcatcttttctcttcccatcctctctttttctatccgagtcacgtcttctatcaggacttcttctatgacgatcctctcttcttccatctctgtcacgacgatctctgttgtttctgaatctttctggtgttctatctctacgacgatttccttcatgagcacgcggatctcttctgttatcttctctttttctctgaatcaatcttcgttctttactaagtgatcgatctcttcgttcagcatctcgtctttctcgcaattcacgatccctacgttcagcactttttgagcgttcccttctaggaggatttctgagttcatcttcattgtttcgagatgattcttttgcttctttctttttagattcgtcttttttagtatcgacttcttctaaagttctcttttttgctggaggaccatcattttccatttcaacttctttttcgcgtttatgttttttctccttcttatgcttcttatcctttttgtgttttttctctttcttatgcttcttctttttatctgtaaataaaactaattatttgaaacaatttaatattctcaccttttccagatctttccgaatcagtcctttgtctcttctcaacctcggaatccgatgccttctcatctgaagacgttccaacatcggatttcacttccccatcctcttcaacacgattgtcctccatttcgatactcgatcaccggcgtttttctgaaaattttcaaattgagattcacatgttctgccgctttcctcatgcacactttcaacccccagcctaactgagccgcaagcgagaaaatattttcagctgataccgggtcacaagatgacgtttcctcataaacttcttggagagtggcggaagaaggtgcgcaaaagacat