Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.6   

sjj_F22D6.6 RNAi JA:F22D6.6
Simmer:F22D6.6:Screen_A
Simmer:F22D6.6:Screen_B
PCR_productsjj_F22D6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22D6.6 Source_evidenceePCR817WS150 Sequence/Annotation Release
Overlaps_Gene F22D6.6 Source_evidenceePCR817WS150 Sequence/Annotation Release
Chunk_score Abs_score733
Max_abs_score733F22D6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70962877097247
Overlaps_transcriptF22D6.6 Source_evidenceePCR817WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.6961atgcaaagccaattccagtcaacctttttggaattgaagcagatatcgatgaaaaagatcagattcgtcgcgcaatcgagattggtccaatactcgaaagacaagagccagttggaatttctttcccggaatttttcgacgctgcatatcaccaagtattcgaagttgctgaaagagagacaattccgaacgaagcactcgaaattcatcgttcatttccaacagattggaaaaagacgagtatttctgaagatcaaatgaaagaagagaaagagaaagctcttttttccaagaattcattgattccagaaatggaacacagcgattgggatccacgacagaattcaatcgaaatgttatcgattgatcaattggaagaaaagttagtaaatagaaaataaacttttggttttaaaactttaacttttcagatttaaatttccctatgattcggatgtagccccagctatcatgcttgcagttgaaggaagatgtacaaaaagtccatttgagtggtatgcaaggccgattgtaaagttagtacattgattgaatattaattgttatttgacgttattttttaaagaactggaagaaatgcgaatggcgaaatggttatttggaacgatgaggaacaattgaaggaagtggatccagttgattggatgatttatggaaatgatcaacttttgagtatggcagagcaattggacacttattattcaaatcctaaaaatagaaaaccattgaaagcggaagaaatgtaattgattagaaatttaatctcgagtttaatatttattttcagtcaatcaatgagaaaagagaagcgagacgtgtttgctgtatgtgcagtaaatgaagaaaaagcaatgtacactggagagtggcaaagagtccttattgtagaatgtgacacttttgctgaagttcgttttctggattcaggcggtcgtgatat