Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22G12.1   

sjj_F22G12.1RNAiJA:F22G12.1
PCR_productsjj_F22G12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22G12.1 Source_evidenceePCR702WS150 Sequence/Annotation Release
Overlaps_Gene F22G12.1 Source_evidenceePCR702WS150 Sequence/Annotation Release
Chunk_score Abs_score641
Max_abs_score641F22G12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1314357913144762
Overlaps_transcriptF22G12.1 Source_evidenceePCR702WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22G12.11184tcattttgagggtttttgcctcgaatttatcgttttcaaacgttcgaaacttagattccaagttgaatttccaacccttactccaacgattaagataaataattttcagagaaatcaatccgaggaggcatacctatccgaacttaaacgccagggattggaaaaacacgccgcaaatgtaaaacaccaagaaacaatgttaagaatgagttgctcaaccgaactggataatcgaagactgcagctggaacatcaagctgaacgtgacaggatcaatttggaatctgaaatgaagaaagggaagttagcggaggctaagagaaacgataaacttgaaaaacactttaatgatgtcgttcaaaacgcgaagagagcgggctcatcgttattaactgcagtggtgtgtttaattgaattggtgcaaaataaagctggagaagattcgaaaaccattgcaaatcgtcaggtaatatttttggagtttttggaattttttgaaattttttggaatttaatgatcattaaaaattcagaagtaccaaatttcagattgcattgagtggtgtgaagaatgaattttataaattggcggaagcatctgaagacatttcaaaactccaggggattaactgcatagaagacaaaatcaacaaaaacgttgcagtagagattttcagtgaaatagccgatgctcgaaattgcatgaacacatttgtggactcctttgaaaatgaaaaaatatcgtttaaaactttgcaagtcttcaggagaagaatagaggttttaatagcacttctagactttctggtggaaattgaacggaaaaatcatgctgctaacgtgatcaatgacagcgagcacttcgcgtttaataacataagaaggagagtgccagtgtggaaacttctatcaatagacatgttcctctacattttgttaattttttccacttttcatttctatcgatatgtttttctcaaggctaatattttgtagcatcccattatagcatcgaatgagcaccaataaatcttggtttgatttagcatgtttggaaatagataaagtatagtcattataatgaaattattttttgtaattgatatgtaaaaagctatgtatatgcaaaacatgcatatgccatgtgtggaaaattattgctataagttatttgatcgcgtgcc