Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22G12.3   

sjj_F22G12.3 RNAi JA:F22G12.3
Simmer:F22G12.3:Repeat_b
Simmer:F22G12.3:Screen_A
Simmer:F22G12.3:Screen_B
PCR_productsjj_F22G12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22G12.3 Source_evidenceePCR957WS150 Sequence/Annotation Release
Overlaps_Gene F22G12.3 Source_evidenceePCR957WS150 Sequence/Annotation Release
Chunk_score Abs_score894
Max_abs_score894F22G12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1315244113153631
Overlaps_transcriptF22G12.3 Source_evidenceePCR957WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22G12.31191atcgataggaaaatcgccctctgcgacatatggtattccaggtgacatatttaaagagtcattgtattgggaagactgcttgtttggtcttttctctccattcataccttctgtttgccatttcacttatcgactctagaaatgtccgttgtatcgaaaactgaacattttcaaccatttcgattattcaatcttccaactgtggcagcatgtaatgttatatcatttatgaggattgttgaagtgtaagtatattaagcaattgtttagtgaaccaataagtttttgttcagaattgaaacgtctatgaccagctcgaaagcgaggaaaaaagtgaaatctttgataaatgccaaactttggaaagaaattgatatttgtcccggatttgattcgaatccaattattcaattggtcagaaactatgacgtttggataatatcattcggtataaagagatactatcccgatactttaagttgtatgaattactacagacttttgcaaaccaacttggaagataagacggctgactggaaaatgtggattgagtatctaactgaattcttggaatctcctatagtcgagctttccatggatatctctgaactgaaagataaacaacaatcagtcatcgattggataaaatctagacaacgttcgattgagaaactctcaatatatggagaaaatgtttcaaccgaggattttgcgatagttgagaacaataaaggtttcacgaaagagttcctgtttgaaatggaaaccgacgaaaacttccatagtgatttcacttttaatggaaagtctctaactgtgtacaagggaaagtggttcaaattgaatcaactattgaacagcgactgtgcggaaatatatatagttaattctttatcagatagtgaatggaacacttttcttagaaaatggatcaatatggaatcgaatttgaatctgaaacgattggagttcgatatcccagaacttcaatcacttttttcaattctcctgctaccctccgaatctgtggccagtattgcaacgaatgccggaatgtgagttcataataattgttgactttaacccaattttatttacaggaacatgattgagaataaatttaaaaacttcatggtaattcgacgcaatgatggagcaataggtgttctcggaatcaggtggacaaaggga