Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F23C8.11   

sjj_F23C8.11RNAiJA:F23C8.11
PCR_productsjj_F23C8.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF23C8.11 Source_evidenceePCR868WS150 Sequence/Annotation Release
Overlaps_Gene F23C8.11 Source_evidenceePCR868WS150 Sequence/Annotation Release
Chunk_score Abs_score805
Max_abs_score805F23C8.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI24499962451099
Overlaps_transcriptF23C8.11 Source_evidenceePCR868WS150 Sequence/Annotation Release
WB_DNA_textsjj_F23C8.111104ttggtctgtatgtgtagcaccagatgttatatacgggtgtgatcatctgcaacattatttaatttttaataagaaaatttcaattgcaggatttgacaatgtttgacaaaagatagtcaaacgtttaaaaattaatcaactcacgattggaagaagctgttggtagaaattggtcaattgcgcgaaagaatctttaccggaaagattcgtctcgttgtagaacttaggcgcatcacagtccagaaattcatcgattccggagattttataagacctttgtattgctttctgattgaccaacgttttcatgaaaactaacaataaccaaattgcccattctgatagatttgtcgtcgtctgctgagcaatattcagattcatcaaagtactggaatatcgggatttatggacgactcctatttcggcagaactcctgaaaaaatcaataatttatattcttaatccgtcgtagtctatacctcaatctgaacatgtgtcaaagttttgtttcggattcctgctctcaccactcgtccgatttccagcaagcttcgatttcgtacagcaacctccaatttttctgaaaaaggaaacattttaaggaagaagaaaaatagaacaaaccaattattgttgtgaaagattgtccggtttgaagatggttgaaaacatcgaaatccactgcagtcgtgtcacgtggcaaagcttttgttggagtcttcgaattcgaagaagatcgtcttttctggtcttcacttgctggcaacatttcgtcttgtctattaaaattgtgtccttcatcgtatgagtagtcaaaatgattttcatcagccaattcttgttgtacatactcctcgtgtacctcttcgtcgtcgccatcgctttcatcttcttcatctataacttcttcgtcttcttcttcgtcatcagatgatttatcttcattataagattttccgcgatttcctgtttctttagattgacatgaaatatttctaggaacactttgcggataactttcaggtacattgatttgatgatgaagacgcattggtttcatcactgcgaacgtacgatccccagattccacgatctcttcctgat