Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F23C8.6   

sjj_F23C8.6 RNAi (7)
PCR_productsjj_F23C8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF23C8.6 Source_evidenceePCR618WS150 Sequence/Annotation Release
Overlaps_Gene F23C8.6 Source_evidenceePCR716WS150 Sequence/Annotation Release
Chunk_score Abs_score653
Max_abs_score653F23C8.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI24209032421848
Overlaps_transcriptF23C8.6 Source_evidenceePCR716WS150 Sequence/Annotation Release
WB_DNA_textsjj_F23C8.6946aaaatgaaaccgtcagcagaatattcatattcacagaaatttcttgagaaatctggaagatcacatgttgcgaagagcagccaggcgttctgtgaggtccttgtcttctgaaacagcttgcgtcccggtcggcagagcagttggcacgtttgacggaagctcctggttgagctcgatgcctgccttgtcggcggcctctgcaatcagagcatccacctgtgacttcggagcattcaacactgtcgttccgtccatcgtcttttccatcgtctttgtggtcacgtcgagatcttcgaaatctctttcgaatctatccatcaactgttgaactttctcgagattcatgctcttcatggcgctttccatggctttcactacgccgctcatgctggcggttactcgtttttgtgtggcggcggtttgaactcgggcggccactgcgtcgattctggcggccattttaatgtagttcactgcttcattcttcttcctgatcgcattttcagcatgaacctgtgcgacttctttgtttcctttctggaaaaaatcgaatttaaaaaataattgttttttttttcatttttaattattttttaccttaatagctgccgtcagcttgtctttctcgaccttttcatccttctcgcatcgttgagcattcttttccaactgtttcgctgcgaatttaagatcaaataagtgttctggaagataaaaacatgaaaataagtcaaaatcaagagaaatcaatttgaaactcactttccaaggccatactgctttctccggctcccatgatgattttatgtgtattaagctggtatttgagtttctgaaatacgagaattacggtgagaaagtgcttttataagttaaatttcgcaagaaagcgataaaaacaaattcatgagtcatgtgtgtgtatctgcggactttacgtcataaa