Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F23F12.6   

sjj_F23F12.6 RNAi (6)
PCR_productsjj_F23F12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F23F12.6 Source_evidenceePCR868WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII64897496490751
Overlaps_transcript F23F12.6.2 Source_evidenceePCR868WS150 Sequence/Annotation Release
F23F12.6.1 Source_evidenceePCR868WS150 Sequence/Annotation Release
WB_DNA_textsjj_F23F12.61003ttggaggaaatcggtattgctccattacaggagaatacttctctccgtccgccaccacttccagccacctgcgttgatgtatcatcagacgactatatcaagcttacaacgctggaacgtcaactggcgcatcttcaagttatggaggactatatcaagctggagacaagaaaccttgaaaaagaattgcttcatgctcaggaagaagtgaagcgtattcaatctgtgccacttgtcattggacaattcctggaagctgtggaccaaaaccatgctatcgttggaagcaccaccggatccaactattatgtccgtgttctatcgattttggatcgtgagctgcttaagccaggatgttcggtggcccttcataaatattcaaacgcacttgttgatgttcttccaccagaggctgacagctccattcaaatgcttcgtcctgatgagaaacctgacatctcttatggagatattggaggtcttgatatgcagaagcaagaagtcagagaagctgtcgaacttccattgactcatggagaactttatcaacaaatcggaattgaccccccaagaggagttctcatgtatggaccaccaggatgtggaaagactatgttggcgaaggctgttgctgcaaatactgctgcttccttcattcgcgttgttggatctgagtttgtacagaaatatcttggagaaggtaattatcaagttttaaaacaccattattgtaacttttagtcttttaggaccacgaatggtgcgtgacgtcttccgtctggcaaaggaaaacagcccatctattatttttatcgatgaaattgacgcgattgctacgaaacgtttcgatgctcaaaccggagcagatcgtgaggtaagattacttcgagattgatagttttttctccgaattttaggtccctagaaaaaagttttgttaaacaagtggtatttttccaggttcaacgtattcttctcgaattgctcaatcaaatggacggtt