Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F23H12.4   

sjj_F23H12.4RNAiSimmer:F23H12.4
PCR_productsjj_F23H12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F23H12.4 Source_evidenceePCR938WS150 Sequence/Annotation Release
Chunk_score Abs_score854
Max_abs_score854F23H12.4
Specificity_index0.255
Rel_score1
Map_statusUnique_ePCRV1235548812356674
C34F6.3 Chunk_score Abs_score247
Specificity_index0.074
Y41E3.2 Chunk_score Abs_score120
Specificity_index0.036
Rel_score0.141
Y54E10BL.2 Chunk_score Abs_score284
Specificity_index0.085
Rel_score0.333
ZC513.8 Chunk_score Abs_score160
Specificity_index0.048
Rel_score0.187
Y41C4A.19 Chunk_score Abs_score419
Specificity_index0.125
Rel_score0.491
M18.1 Chunk_score Abs_score133
Specificity_index0.04
Rel_score0.156
C34F6.2 Chunk_score Abs_score247
Specificity_index0.074
Rel_score0.289
T06E4.4 Chunk_score Abs_score138
Specificity_index0.041
Rel_score0.162
F26F12.1 Chunk_score Abs_score67
Specificity_index0.02
Rel_score0.078
T28F2.6 Chunk_score Abs_score293
Specificity_index0.087
Rel_score0.343
C09G5.5 Chunk_score Abs_score243
Specificity_index0.073
Rel_score0.285
T28F2.8 Chunk_score Abs_score144
Specificity_index0.043
Rel_score0.169
Overlaps_transcript F23H12.4.1 Source_evidenceePCR938WS150 Sequence/Annotation Release
F23H12.4.2 Source_evidenceePCR938WS150 Sequence/Annotation Release
WB_DNA_textsjj_F23H12.41187gtcgatatcttcgtacggacaaccccgcattgggcggggcgacgtatccgcggatcgccgtcgtataaaaggacgagcaggcggtgaagaaactcgcatcagccttccttttgcaacacattatggaaactgacggtaggctcaaagcctacaaatttgtggcctatgccgctgtgggtttctctattgccgccgtcgcttcagttcttttgacccttccaatggtctattcgtacgtgtcgcacgtcagacagcagatgcaccacgaaatcaacttctgcaaggtaatatttattttaattaatttcttacatatttttttattgcaaattttgatgttgatatatgttcttttgtataatatttatatcttttattatttctagggatctgctaaggacatctttgctgaggtcaactacatgaaggccaacgctggaccagttccaccacgcaaccgtaccacccgtcaagcctacggaggaccagaagtcaacccagctccaaatctccaatgcgagggatgctgccttccaggaccaccaggaccagctggagccccaggaaagccaggaaagccaggacgtccaggagcaccaggaactccaggaaccccaggaaagccaccagttgccccatgtgagccaactactccaccaccatgcaagccatgcccacaaggaccaccaggaccaccaggaccaccaggagcaccaggagacccgggagaggctggaaccccaggacgcccagggaccgatgccgccccaggatccccaggaccacgtggaccaccaggaccagctggagaggccggagccccaggaccagccggagagccaggaaccccagctatttccgagccactcaccccaggagcaccaggagagccaggagactctggaccaccaggaccaccaggaccaccaggagcaccaggaaacgacggaccgccaggaccaccaggaccaaagggagccccaggaccagacggaccaccaggagtcgacggacaatccggaccaccaggaccaccaggaccagctggaaccccaggagagaagggaatctgtccaaagtgagttttgtttaaaaaggttaggataatttataaatttgtaatatttcaggtattgcgctctcgatggaggagtcttcttcgaggacggaaccagacgataaacata