Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25B3.1   

sjj_F25B3.1 RNAi JA:F25B3.1
Simmer:F25B3.1:Repeat_a
Simmer:F25B3.1:Screen
PCR_productsjj_F25B3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25B3.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
Overlaps_Gene F25B3.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
Chunk_score Abs_score670
Max_abs_score670F25B3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV95540169555189
Overlaps_transcriptF25B3.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25B3.11174caaatgattccagagcagcaggtattttgattgaaaaaatacagtttatttcacataatttgtttttttaagctgcaagacaacaaatcgacacgacagctacaaaaatgatggaatggatcaaagaggaaaaggaaatcgctccgcctattgttccagcacaccgaaaaccttccggagagaatgaaaaccctgcaaaaggtaattagaaatcgttttttaaacctaatcgttagaatttttggctagaatattttcatggaaaaaagtcatatagcctaaattcgtgtgtggtcatcaaaaaatttgtagatttttttcatttttttttcaaggaacatcgaaaatcgaaaaaaaaattcgaaaattatccagaaaatgatatatcaaaatttgtttatgttgatgaagaaaaaggattaaaaaaaccaaaataaatactcgaaattttttttttcaatttttcggaaaacgaaaaatcgaaaaaccgacacccgtggctcttatagaatgtatttcagttcgtccccaatggagagtatcagctgaagaagaaaaaacgtcacaaccagcagctccagcgccaattgcaaccaacagacatagtcggtcaagccgtgcttcgacagaagaaaaagcgtctacaacaatagaattccgtgtggattccaattctcggcatgttccagttacagcaatcgctacaccatattatcttcaaagtggaacaatgagtagagggtattgtttggttacttttctcacaatcataattttttttcaatttcagaagatcaaattctccgagagctccatctagagatgctgtccctcaaccgatcgatggagagactttactttcatggtgtcagagagttactaacggatattcgcatgtaaaagttaatgattttatgaaatcttggaacaacggattggccttgtgtgcagttcttcattcttatcgcccggatctcattggagattacgaaacactggatatctctaataatatgtctggacgcatttcgaatattcaaagagccctcgattcacttactttgataggaataacagaagtaccaacagttgatatgtttctgactcctgatcggaaacaaatagaatttcttcttcaacatcttcgccgaatctttgaaggatttgacgaggg