Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25B4.6   

sjj_F25B4.6 RNAi JA:F25B4.6
Simmer:F25B4.6
PCR_productsjj_F25B4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25B4.6 Source_evidenceePCR948WS150 Sequence/Annotation Release
Overlaps_Gene F25B4.6 Source_evidenceePCR948WS150 Sequence/Annotation Release
Chunk_score Abs_score822
Max_abs_score822F25B4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV56858025686992
Overlaps_transcriptF25B4.6 Source_evidenceePCR948WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25B4.61191gctgacgctagaccacttccataggcgaagaataaaatgcttttctccccggtgacgctgaaaagtaattttaaaaattagctctaaaaatcggtatattcttcatcataccaatcatctgctgccaagtatgctaaaagttgagcaaagagtgatggagtatacatatttccgattcgcctgttgaaaacaagatatggatctgttttttccttccaaacttgagcagacaattcgatcatttttgcaagtccagcgcgatcgttttcatcgagtttatgatcgacaccatttccatttctgaataaaataaacatttgaaaatttttctaaactaatcaacctacaattgcttgtgacgaagttgcgagtcagtatagttcatcacagccaggcctttttgaaccattttcgtgaacggtgagtgaagaaacactccgtcaaatgagttcagcccgtcgatacccgttgtatggcgattaacttttgatatgaaatatgtgtatgtcattctgactgcttccaaatatgagctcaatgataatgatccatcgacaacggggtattcactcggaatcggcgctggaatttaattttttaaaagtaaatagagaaattaatagcttactaattggcttaaagaaatcccacgtgtttttcatgtgacacgctgaaaactgccgatcaatcggaatagaagcatctggacaaataagaaaagcaatcgctcctgcaccgcctgtacatctcgctggaccttcttcatatattgcaatatccgcgactactacaattgcgtttttcttatcaagcggatgattcactgtgacccaatcgatagcgtgcagcagtgcctgaaaatataattgaagattctattttgagagacaaaaaactcacttgtgcgcctccaaagcaggcatttttgatgtcgactccttcaatatccgaatttccaggaaataagtccattaaagctgtcttcacacttttgctcttgtcgatcattgtttcggtacctacaaccaaacagccaatcgaatcagtcgagatctaaacacactgaaactgaggaaactaagtactttgatagcgaatattactttgtaagtttcaataagtttccttgtgactgtaagggagatggatacgatgtcctcgttgtccgagcagaatcccatttgctgttgc