Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25B5.4   

sjj_F25B5.4RNAiSimmer:F25B5.4
PCR_productsjj_F25B5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25B5.4c Source_evidenceePCR222WS150 Sequence/Annotation Release
Overlaps_Gene F25B5.4 Source_evidenceePCR1065WS150 Sequence/Annotation Release
Chunk_score Abs_score1349
Max_abs_score1349F25B5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII59424365943598
Overlaps_transcript F25B5.4c Source_evidenceePCR222WS150 Sequence/Annotation Release
F25B5.4a.3 Source_evidenceePCR1065WS150 Sequence/Annotation Release
F25B5.4a.2 Source_evidenceePCR1065WS150 Sequence/Annotation Release
F25B5.4a.1 Source_evidenceePCR1065WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25B5.41163ggaaagactatcaccctcgaagtcgaagcctctgataccatcgaaaatgtgaaggccaagatccaagacaaggaaggaatcccaccagatcagcagcgtcttatctttgccggtacgttatatagatatacataactcaaatcaactattattatttcaggaaagcaattggaagatgggcgcacgctctctgattacaacattcagaaggaatctactcttcacttggttctccgtctccgaggaggaatgcagatcttcgtcaagactcttacaggaaagaccatcacgctcgaggtggaagcttctgacactattgagaacgtgaaggccaagatccaagacaaagaaggtatcccaccagatcagcaacgcttgatcttcgccggaaagcaactcgaggatggccgtaccctttcggactacaatatccagaaggaatcaaccctccatttggtgctccgtctcagaggaggtatgcagatcttcgtcaagacattgactggaaagaccatcacacttgaagtcgaagcctctgataccatcgagaatgtgaaggccaagattcaagacaaggaaggaatcccaccagatcagcagagactcatcttcgccggaaaacaactcgaagacggtcgtaccctctccgactacaacatccaaaaggagtctactcttcatttggttctccgtctgagaggaggtatgcagatcttcgtcaagacattgaccggaaagaccatcaccctcgaagtcgaagcctccgacaccatcgaaaatgtcaaggccaagatccaagacaaggaaggaattccaccagatcagcagagacttattttcgctggtgagttcatattgtttttagaattaaaactaatttttattgtttttcaggaaagcaactcgaggatggccgtaccctttcggactacaatatccagaaggagtctactcttcatttggtgctccgtctcagaggaggtatgcagatcttcgtcaagactttgactggaaaaaccatcactctcgaggtcgaagcttcggacaccattgagaatgtcaaagccaaaatccaggataaggagggaatcccaccagatcagcaacgtttgatctttgctggaaagcagctcgaggatggacgcactctatccgattacaac