Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25F8.2   

sjj_F25F8.2RNAiJA:F25F8.2
PCR_productsjj_F25F8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25F8.2 Source_evidenceePCR846WS150 Sequence/Annotation Release
Overlaps_Gene F25F8.2 Source_evidenceePCR858WS150 Sequence/Annotation Release
Chunk_score Abs_score753
Max_abs_score753F25F8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI48851764886849
Overlaps_transcriptF25F8.2 Source_evidenceePCR858WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25F8.21674acaggggaaaatctaaacgagagactctggagtggaagcattggcagacatgataagacatgatacccagtagataacattgaaagcgagaaaggcaagtgggacgacaaatctggcatagaaatcaatttttgccggtagataatctggttttgtgaagtaacggcggactttgtcacggaatgtctcgcgggcttcgaactgaaaaattgactttttttcgcatatttttctaacatatttatgagtattttttgcaagattattccggaatagcgacttttacataggttactacacttaaaaaaatagctacatacaataacttttaaatggaaaaaagtcgacgttttgtgtttttagtggtatcatgctggaagctttttggaagctgtttgcattttgaattctttcaatatttgagatcgtttcaaaaagttgaatctttttatttgtcacccagtgaatttatacaaaaagtttttttgttgaatttttcaataacattggcgaattccaggaccaaaactttttgatgattgttaaaattcaaggcttaacctacagtatgacaggtgcacggtggctgatagacttctgcatccaccatttccaacttttctctccttctctgcgccttccttgcagctttctctcttgacctgtcattttgccggacactatcttgataactgacaaatgcgtattccagaagtgctccgaatacaaatgtttggcacgctggaagtttctttgattgttagatatattaaaggagttactcacctccaagccagacatccacaacttttacgtagctaactggtggaagcttggcgttgattgcagattgctgaaagttctttgttgaagtgcacaaattatttttcagtcccttaccattgtagtcattgtaagaagcgtagtgactcctaaagcgacacgtccagcagttgaatgaagatcaatccaaaatgaaacccatgagacaatcacaatcatagtggttggagcatacagttgtaccaagtaataactgaattgccgtttgaacaaaagttgcattcggagacatccatatgatcctgtaagaaatctggatttagttctttatataggttcttctcatctttttggaaaaccccacaactaaatttagcaacaattttttaaaccccctattttctatcggaacttgatttctgattattaatgttttcccaatttatttgcaacaaaatttgccaaacttcccaacgggcttttctgctcaaacccccaaaatacacttctttccgtgaaatcatttgttcaacttttttcccttcattttcccacgtcacaacagctataaaatcctctcaaaaagtgcaaaatctgttgacaaaagctcatatctcttctctcccccaatcgcctcaagaagttgcaaaaaatttgtctacctgtgttcgtgtggcttgtgcaatctgcatttgttgtgtagtttttgagtataaaattgggaagatccgagccaacgccgggtttcagttgaactggtgttgatggatcccactcgtacatgatatcattcattgtgtgcgcgtagctgacaagatcaaagttacacgattgatagtcgagtgggtagagttggagacgcattgggcaggaacttgtcaaacttatccg