Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25G6.9   

sjj_F25G6.9 RNAi JA:F25G6.9
[cgc5655]:F25G6.9
PF:GL1_3C6
PCR_productsjj_F25G6.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25G6.9 Source_evidenceePCR1187WS150 Sequence/Annotation Release
Overlaps_Gene F25G6.9 Source_evidenceePCR1187WS150 Sequence/Annotation Release
Chunk_score Abs_score1166
Max_abs_score1166F25G6.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV85686058569791
Overlaps_transcriptF25G6.9 Source_evidenceePCR1187WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25G6.91187tcctccttgccaaaaatgtcacaaattcttctgatgttcatcttttcacctctgcgagcttccaaccatacatcaaagcagttggaaatttgacctccgaatgcgtctggatcttttatcgagttcagaattggatcagtaattccagaaatgtcaaacagtttcggaagacatttcatcaaaaagttatgaacagttgaatctttttgtagatctgatagagccattgaaagctttttcgatgtttcaacatcttcttttctcgcttgaacggccatttgaacaagaatcatcgtaaactcctttctagggaacaattttgaaaccgatcgtagattttcagaaagtaccaaaagttccttcacagtcaaagaactcgaaaaatggaaaattacttctgagatattttgttcacatgccaacgtaatcatcgccaaacgagcatccgtatcagcttttgtccattccgatctttctaagaacttcatccagtcaattggtggaaggaatcgtccatcatttcttctgtgattaacaagacagcggatgatgtttcgaagagtttccggtttgacatttattttcttatcgaacaactgaagaattcctttcaatatgccttcaggtaactttccagctggtatgaccattttgctgcgacctgttccagagattagagctaactcagctaatccttcgtagatttttctcctcacttcattgtttccattattccaaagtttttcaagaactttcttattattctgttctatttctttaagatctttttttggagaggaaatcaatccattaaagaacttttcaatactttcatcatcaaccagctccgtttcttcatacttttctgtcttctcgtcaataactatattgtacgcaacttcaaacgctttcgcactcatctgactagcaccgtaagcctccgcagtcacccacatcatttttcgatcaggaatttcctctttcttaagctctttcgtggaatcttgcaataaactgacaagcatccgatcatcagtgagtccaacatcttcatcattgtaaaatgcagcaacacttgggtttaaatacagaagacgcaaacagaatatggcagtgagtagggaagacttatttgaatgggttatcaattgatatattggctcatttttcgcaactcgtttctcctt