Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H2.10   

sjj_F25H2.10 RNAi JA:F25H2.10
Simmer:F25H2.10:Screen_A
Simmer:F25H2.10:Screen_B
PCR_productsjj_F25H2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F25H2.10 Source_evidenceePCR788WS150 Sequence/Annotation Release
Chunk_score Abs_score725
Max_abs_score725F25H2.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1056780710568754
Overlaps_transcript F25H2.10.1 Source_evidenceePCR788WS150 Sequence/Annotation Release
F25H2.10.2 Source_evidenceePCR783WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H2.10948tgttgcactaaaaccaccgattttcaaaattgtacattttcagacctcagttttaatataatttattttttcagtctttaaaacgtaaccgcacgcgatccttaattcaccaagatggttagggaagacagatctacttggaaggctaactacttcaccaagcttgtcgagcttttcgaggaatacccaaaatgccttctcgtcggcgttgacaacgttggatccaagcaaatgcaagagattcgtcaagccatgagaggttactatttttaatattctcaattcctttaaatcgtaattttcaggacatgctgagatccttatgggaaagaacaccatgatccgtaaggctcttcgtggacacctcggaaagaatccatcccttgagaagttgttgccacacatcgtcgagaacgtcggattcgttttcaccaaggaagatctcggagaaatccgctccaagcttttggaaaaccgtaaaggagccccagccaaggctggtgccatcgctccatgcgacgtcaagcttccaccacagaacactggaatgggaccagaaaagacctctttcttccaggctcttcagatcccaaccaagatcgccagaggtaccatcgaaatcttgaacgacgttagttttcatttttaatagtatattgtaatgttttcattttaggtccatctcatcaaggaaggagataaggtcggagcttccgaatctgctcttctcaacatgttgggagttactccgttctcatatggattggtcgttcgccaagtttacgatgatggaaccctctacactccagaagttttggacatgaccaccgaggagctccgcaagcgtttcctttctggagttcgcaatgtcgcttccgtctcgttggccgtcaactacccaactctcgcttccgtcgcccactctttggccaacggacttcaaaacat