Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H2.4   

sjj_F25H2.4 RNAi JA:F25H2.4
Simmer:F25H2.4:Screen_A
Simmer:F25H2.4:Screen_B
PCR_productsjj_F25H2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25H2.4 Source_evidenceePCR560WS150 Sequence/Annotation Release
Overlaps_Gene F25H2.4 Source_evidenceePCR605WS150 Sequence/Annotation Release
Chunk_score Abs_score542
Max_abs_score542F25H2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1055199710552997
Overlaps_transcriptF25H2.4 Source_evidenceePCR605WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H2.41001cctactcgacaatcatccttcactgcctgaaatacccggcaaagggtgtttttggactgctgattggaaacaagaaaggagacaaagtcacggtacaattttatttgtttaattcattaaatgcgaacattttaaattagttgatcgtcatgtcggtacgcttattttctccaaagacagtcgtctttaataccaattatcgatatattagaattgctaagctgaaagcaagaaaaaataattacgctctccacctcaaaatgatgaacagttgctgaagagagcataaaaaatacttttctacgttttgagaagagttatgcgatactagatttctgagtcagggaaatgttttaatttaatgaatttgccatcctatctgataatttattttccaggtaacaagttgtgttcctctttgccatgaatccactccactcgcacctcctctggaacttgccacagccctcgtccatggaaagtttggtgcctccctcgtcggcgtctatttctcaaatgcaactccatcggacacttctctcaacgtttatgccactcgactcgccgacagaatatcttctgttacctcttcggcagcgattctcgtacaagtgatgaacgaaagactggtgtcagattgtgaacaagaccgcctcgtggcatatgaaaaagatggagatagttggaaagaaacgaagtaggaaaaaacatttgatgttatatattcatttagtatattcatttcagaacgattttccaaggttccaacttcttgcgtggccttcaagctgttattcagaagaagttgtaccgagagctttccgatttcgaaaaccatttggacaatcccgagttcgacttctataacacaaatctgagcaacaaactcgtgcaagtggcggaattcagagcttaaaagctgaaattattatcctaattcgtgttttcataacttattgcagtcatctgaatatattatatgtttaatccccttccgtttt