Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H5.3   

sjj_F25H5.3RNAiJA:F25H5.3
PCR_productsjj_F25H5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F25H5.3a Source_evidenceePCR973WS150 Sequence/Annotation Release
F25H5.3b Source_evidenceePCR973WS150 Sequence/Annotation Release
F25H5.3d Source_evidenceePCR973WS150 Sequence/Annotation Release
Overlaps_Gene F25H5.3 Source_evidenceePCR973WS150 Sequence/Annotation Release
Chunk_score Abs_score891
Max_abs_score891F25H5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI91750169176119
Overlaps_transcript (5)
WB_DNA_textsjj_F25H5.31104cactacccatatggagcatttgtgtcgtttggacattcgtgaggctccacatctcgttcgtcagaccggaattatttgcacaattggaccagcttgtgccagtgttgaaatgcttcaaaaattgattctcaatggaatgaacattgctcgtctcaacttttcccatggatctcatgaggtatgagaactttcaaattttatttaattcaaactttgaatgttccaatcgtgatttttttcaattatatatttcagtaccatgccggaaccatcgccaacgttcgtgaagctgccgattcattctctgacaagcgtgtcattggaattgctttggacacgaagggacctgaaatccgtactggacttcttgccggcggtgcttctgctgaaattgagcttgcacgaggagcatcaatccgtttgactactgatccacacttttctgaatcaggaactgctgtcaatctttttgttgattacaagaacattgccaaagttctttcggttggatcccgtgtctacattgatgacggacttatctcattgattgtcgaagaattgcaaactgacgctgtcatttgctctgttgaaaatggtggaatgttgggaagcagaaagggagtcaatcttccaggaactatcgttgatttgccagctgtttccgagaaggactgtaaggatttgcagtttggtgtggaacaaggtgttgatatcatctttgcttcattcatccgaaacgctgaaggaattcgtacgattcgtaaagttctcggagagaaaggaaagaagattaagattattgcaaagattgagaatcaagaaggagttgataatgctgatgaaattatctctgaatctgatggagttatggttgctcgtggagatctcggtatcgaaattccagccgagaaggtgttccttgcacaaaaggtttgactttttctatcgtatttcagttttaattttacttttttcagatgctcatctccaagtgtaatcgtgctggaaaacctgtcatttgtgcaactcagatgcttgaatcgatggttcacaagccacgtccaaccagagctgaaggatcagatgttgccaatgctgtaagat