Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H5.5   

sjj_F25H5.5RNAiJA:F25H5.5
PCR_productsjj_F25H5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25H5.5 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene F25H5.5 Source_evidenceePCR848WS150 Sequence/Annotation Release
Chunk_score Abs_score785
Max_abs_score785F25H5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI91604059161518
Overlaps_transcriptF25H5.5 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H5.51114atatcatcgccttgtttcggctcatcgagcaacatcaattcttccgcctgaaaatattatgtaaaataacttcaagaaacatataacttttttaaaaactatgcataacatttgaaagaattttaatatttttggatttcatttagaatataacaaaatcaaaaggagtaataatttttaattaccttttttcgaacaatgttttgtgctcaaaacattttttgtgggaaattattatcaactcacatgttcatatttgaacttgatcatttcggctcgttccttctttttttgttcatcttcttctggttcatcatcttctccatcaccatcatttccatctacatcatctcccatttgaatttgaacttcttctcgtaacttgaaacggaattgacgattcgtctcaactccaccgagatctccgtcggcaagtagacggtcttgaagttttgcaagctctctggaaaattataaattaatttttgattctacatgccaaagtaaaaaaaatagagaaaatatattacctttgttccttatcgttttcctgtttcagcaacaacttatgattctgcctccgaatagtatcattatcgggaacatcatctgcatctccttcttctgcttcataaacgttttccatgccttcttcatcttctagatcacttccaacatcatcaccggaaagtgaagcttcatcatcaaaaagtgttctctttttgattttttgtttgtattcttggtgttgcaaacgtttcaagatagctaattcatcgtcttcatcgtcgaaatttggatccggagcttctactccttcggtttcagcttcatcattctcactctcgatgtcatcttcctctggttcttcttcatcatcaccttcttcttcagcttcttcagcttcttcatcactatcttcaccatcactcagaacaactcttttcagctcggttttttcttctaaaactgtttctatcttttcagtgaattcaccagatttttcgcaaatttctttgatagtttcggaatcttccaaagttcccgatccaaaaacgtcttggcttggcaatgtctcctcgatgacgtcatcttcttcgtccgaatccaaaac