Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H9.6   

sjj_F25H9.6 RNAi JA:F25H9.6
Simmer:F25H9.6:Repeat_a
Simmer:F25H9.6:Screen
PCR_productsjj_F25H9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25H9.6 Source_evidenceePCR663WS150 Sequence/Annotation Release
Overlaps_Gene F25H9.5 Source_evidenceePCR99WS150 Sequence/Annotation Release
Chunk_score Abs_score78
Specificity_index0.098
Rel_score0.109
Map_statusBottom50_percentile_ePCRV1346961913470809
F25H9.6 Source_evidenceePCR817WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714F25H9.6
Specificity_index0.902
Rel_score1
Map_statusBest_ePCRV1346961913470809
Overlaps_transcript F25H9.6 Source_evidenceePCR817WS150 Sequence/Annotation Release
F25H9.5 Source_evidenceePCR99WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H9.61191taaaagatctcactcgttttcgcttacatggaagaaaattcaacatttactaatgtttttaaagcttgtacgattttgaaaaaaataaataaattattgttggtgaattatgttagtattcaacattgaaaatagaagaaaaatatgatattgtctacccgcattggatgcgaactgcctgctgatccctgacaagtgctgcaacaagtgaaacgatcgtgccgattgaagccatcgcaccggttccaacatctccacaaatcaactctttttgaattggacagatttccttgaatttcaattgagacttgagaactgtccgatgttgcattgtaagaggattctcccacatatgagtgttcattgctggagcaaaatagcacggtttcgatagatcccaagctctgatgattgaggttacgagattatcgcacaagccgtttgcgatttttgccatggtattcgcgtcgagaggtgcaatcaaagcggaatctgcccattttcgcaactctgaaaaaaaggatttttgttgaaaacttattgagggaggagtgatattttgaaaagtgtgctcaaattaacgaatttcgtccaaaaatgcaattatagaatataatcaaataaaagataactttcaacagctgtggcacgaaaagttggcaaaagtaaaaattttagctaaacttagctaaattaataatgttaaccttcataaaacaaatgttaattttttttaaaagttcattacgaagttcgttcatttgagcacattttgagtctaaacgttcaaaatccgtaccaatatgaagaactttatcgcctcgctccctccacatagaccattcatctctgtcttcgtagacaatctcgtcaaattccaatttttgaatatgacacagtttcattgcattttcggtggttacaacctattaaattttttaaatttacatgtaaatatcacaaaccttgattaaaatccgatcacgtccgattttctcatataattcactgattaattctggtgccttcatgacagcaatgctaccggttagaattaatagtaaattatgttttcctgattcatcacgaacaattttgtgagtccgggtgagtggtgggcggatctgcaacaaataaacgtttggaaactctagaaaacataattttcacctcaggcataatttcctcaat