Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26B1.2   

sjj_F26B1.2 RNAi JA:F26B1.2
PF:GL1_3C4
PCR_productsjj_F26B1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F26B1.2a Source_evidenceePCR910WS150 Sequence/Annotation Release
F26B1.2b Source_evidenceePCR21WS150 Sequence/Annotation Release
Overlaps_Gene F26B1.2 Source_evidenceePCR910WS150 Sequence/Annotation Release
Chunk_score Abs_score847
Max_abs_score847F26B1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI63185446319728
Overlaps_transcript (8)
WB_DNA_textsjj_F26B1.21185tttttcccttcagttccgtgtttcttttgcaaattctgtcaatatttcagcgtttgcaccgttactgctgatgagaagactgttctcaacatcttgaaggatgtgcttccacgtttggaagatgtaagttgaaagacaaatttcaattactccgcaattttgtgtttttcccaacgcattaaaaactttcagaatttctcggagcgcgatccgtgtgaagtgcgcatgctcgtccatcagtcacatgctggagctcttatcggacgcaacggatccaaaattaaggagctccgtgagaaatgctctgcacgtctgaagattttcacaggatgtgcgcctggatccaccgatcgtgtgttgataacatctggagagcagaagaatgtgttgggaataattgaagaagttatgaaggagttgaaagaaattccaatcaaaggatctgcaactccatatcttcctgcattcaactatgatccttccaacatctctgattatggaggttttcccggaaacatgcctgcaggtggaccaccaaacaatcgcggtccagcgccacaacgaggagggcaaggacctccaggtggaccaagatcgtatggaggagctattacacaaggaggtggtcagagatccttcgaagccggcgatttccaacagttccgcggagggccaggacctgttccagggtacgctatgagtgctccaggatatcctccacaacaaggacaattcggtgctccaaacaatgctggttatggttatgggcctggtggcggaggaccagttactactgcgcaggtaatttataaaaaacgtttacgctacgcgcttcttaaaacgtataatagtttaaaaaatcaaacaacaatgccttagtgcctttacatgaccatgaagacgtttcaggtgacgattccatccgaccttggaggtaccatcatcggtcgtggcggagaacgtattgctcgcattcgtcaagagtctggagctcagattactctcgaacaaagcaatggacaaccggaacgtatcataactatcaaggggacggaacaacaaattcacagtgctcagtatcttcttcagcaatggtgagtagtgaaaaacaataaaacatatgtttaaagttgttgtttcagtgtccgcaattcgacccaaggccgtgaacgattcggtggatct