Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26B1.6   

sjj_F26B1.6RNAiJA:F26B1.6
PCR_productsjj_F26B1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26B1.6 Source_evidenceePCR750WS150 Sequence/Annotation Release
Overlaps_Gene F26B1.6 Source_evidenceePCR750WS150 Sequence/Annotation Release
Chunk_score Abs_score687
Max_abs_score687F26B1.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI63132876314747
Overlaps_transcriptF26B1.6 Source_evidenceePCR750WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26B1.61461tgtttcattaggtttcaaatgggcaccgtactttcttcagaacatatcaattcttataacagaaggtttatttgctcgtttctttatttactttacaccaatatgccctgttctcgctgattactttcaatctccgcttgttgggtttaagattataatgttattaactcatcatgtatcaatttgtaaatcccttttacaagttttgttagttttaaatcgaatgacgtgtgtcctgtttccaataacgcacgattcaatatggagaaaaagcttgaaatatgtgattagtgcagtttttttaattccattttgtgctgactggaatattgctatatctcgagtttacatgcaatccacgtatggaggtttctgggttagctatttcaagaaagttagctgggtaagttcatctgtttccatttcttttttgttttaaaactaaaagaaactgaagaaactgttttaatgaaccacatacagaaaaataaaagatgaactggagagacccttacaaaataaatgagtgtgactttaaggattccagattataccaaattagacatattacctcacatgcgaaaaactacactttcgactgaactttttgttcaacagtctcggatcccgagacgagtaaaatttttcagctaccgtacccgcaacaatgatagatcatcaatctttctatttgtcattctctctttttgtgttgatcatatttctagaattatgcgttttttaattctgaaatattgaaaagttctgggaaaacgagaagataagcgggtacagtaacccaacacacttgttcgtgacaagaactgaggctgggagcacattaaatatgtacattatatttaatatttattgtttcaggcaagccaatctcgttttcaacttgtttttattattattgcattatcatttacatttatatgcactgcaattactttgttaaaacttccagaaagatcaaaagaaatagaaaaagcaatctctaatgcaacggttatcatatccattgggttcacttttaaagttttatttcaggttattaacttctgaattttaaaaaatatctagaacattcagatatactacagctttttcttctcatacactgatgcatcaagccccgtttatggatttagctttttagctctagactttttaactgttggttctccaattgtaatgatatgtgttagcagaaatcttcgaactcacatttttaaaagtaaacgaaaaaatcagacactgtcaaaaatgttaactagaacttccggaatggtgattgctcgttgaactttttcgaataaagtattgtttattcaacagtatgttttattcaatcatgttgaaatgcatgctgcaccgtttttagaactacggtagattactgtacaattaaggttagatatatcgtggtatttatattggagtttgtgttttctgcat