Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26D2.15   

sjj_F26D2.15RNAiJA:F26D2.15
PCR_productsjj_F26D2.15
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26D2.15 Source_evidenceePCR836WS150 Sequence/Annotation Release
Overlaps_Gene F26D2.15 Source_evidenceePCR836WS150 Sequence/Annotation Release
Chunk_score Abs_score750
Max_abs_score750F26D2.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1644033616441515
Overlaps_transcriptF26D2.15 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26D2.151180cgtctcttgtaccatcaatgtcacagtttcggggtgggtatataaacatactcacccaataatttacatgtcacaatttcgagagattgctcattatggctcgtttttctggaaaagttgctctgatcacaggtgagtaagactttactttattttttgaaagaaatctcatccttaaaaacatctttaatgtcaagacaaaggctttaatgtcaagattgtgctcattggttcaattttgtcaaacaaaaggcttagaatttcaatttcaaaactcatgaatgtttttcttaggatcttccaacggaattggccgtgccgccgctatcctctttgctcaacaaggggccaaagttaccataaccggaaggaatgctgagcggctgaaggaaacccgacacgaaataaaaaaatctggaatcccggcagaaaatattcttgcgattgtagccgacgtgatcacagatgaaggacagatgaggcttatcaacgatactgttcgaaaatttggtcaccttgacattttggtgaacaatgccggaggagcattgatggatgctcaggggcgtgttggaatggatcaggatatttcggtgttcgataacactatgcagatcaatatgagaagtgtggttactttggtgcaaaaggccaaggagcatttgatcaaatcaaagggagaaatcattaatgtttctgccatggcagcaggacaccatggggtaagtttacgctggaactaaactttaattcaactttccacaggaccccatagcaactttctacggaatgtccaaggcagctcttgatcagttcactagaagctctgcgatttctctgatccaacacggagtccgcgtgaactccgtcagtcctggatttactaagacaggattcggagaagccatgggatttccaccaatagcgatgaaaaaggtaaaccttatattgtgatctttttaaaatatttattaaaccaggtcataagcttctacgaatcccacaaggagtgtgctccgagtggtgcaattgctcaacctggagacattgctcaagtcattctattcttggcggatagaaccatgtcctcatacatcatcggacaatcaatcatagctgacggaggatcctcgttggtgatgggaatgcacgctcatgatatgcttgacattttgaaggc