Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26E4.5   

sjj_F26E4.5RNAiJA:F26E4.5
PCR_productsjj_F26E4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26E4.5 Source_evidenceePCR772WS150 Sequence/Annotation Release
Overlaps_Gene F26E4.5 Source_evidenceePCR772WS150 Sequence/Annotation Release
Chunk_score Abs_score688
Max_abs_score688F26E4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI97691559770277
Overlaps_transcriptF26E4.5 Source_evidenceePCR772WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26E4.51123ggctcaaagcacatttccatgacttttgcatcatcagttggcatatcacttggaggtttcaaacgcaggttttcgtgagcaacttttcgtcgaagttctttcaataccttaaacacattttctcaataaaaattaaccaaatattcccttttaccttaacatctgcatatggatattctccactgaacacttcaaacatcacaactccaaaactccaaacatcagattttgatgaataaattccttttagaagagtttctggtgctaaccatctgattggaaccttcatgagtttctgctccttgtgcaattttccgaagagagaaagaccaaaatcactgatcttacaattgtcggatttatcaagaagtacattacgagctgccaaatctctgtgaataacttgttttttctctagatatctcatcccttttgcaatttgtttgcaatattttcttttcaacacatcactcaattgttcatctttcttctcgattcgacttttcaagcatccaccagaacataattccattacaatcattattggttcttgttgagttgcaactccatacaatcggacaacatacttgtggttcagtttcagcatcagattagcttcacgaaggaatgttattctgaaaaatatcagtattaaagtagtgcggatttattcggatgggtctcgcagtgataaaaaagtgttttaataaaaaaagctgtatacatttcatttcgtttcgagaccagcaaccgtatacttgcgtcgcaaaaccgctaaattgtgcatttgggaaatatgcaacatatcccggcgagataccacataatttaattaaaaattatataatttaaatcgttcaagttttcaatgagtttacctttcatcagctgtaactttacttcctttcatcgttttcacagcaacttccacatcatttgtgaatattccaacagatagaactccttggaaaacctctccaaactctccgtttcccaatttctttcccaaattaatcttaaagatttcagataattgagcaaacatgaatatttgtgcatcgaagaactctaaaaacctgctcatggtacaattgccattcttctctgaccacccaactgaaca