Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F26F2.1_f   

sjj_F26F2.1_fSequenceTCGATTGTTTTCCATCATTCTCT
Length23
In_sequenceSUPERLINK_CB_V
PCR_productsjj_F26F2.1