Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26G1.7   

sjj_F26G1.7RNAiJA:F26G1.7
PCR_productsjj_F26G1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26G1.7 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (28)
Overlaps_transcriptF26G1.7 Source_evidenceePCR451WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26G1.7969ataaaaccaagaacacaaagccaatacaatacgactttattttaaacttttgatgcatgatagttcatacatgcctacggattgtactcagttgggaggcaacataggcctggaagcagtctggcacctaatgcaagtcttatgggatcaaattcggaaacatttaaaatctgaacaagacagaaacaacaacgaggaattttcaaaagtcatttattgaacacaagatcaagcagggctctatggattgtactcaatggggaggttcttacgacgaaccataccgtctccttggaaccactctcggcggaactgcctggcagctccatccggggtgttggtccactcaacagtgatacgatcgttgttagtgtcctcctgtccgaaggcgaaggcatcgcatgacacggcaagaagcacagcttcctttgggtccaaaactccacatggtggatcaactccaagtctcttcatattggtggtcttgattccatatccaatacggcgagcagatgaattgatcaccttaatgtggtaggtgtgcttgtcgtcgtatggtgcattgaagacgatcttcgtacccggctgggtttggatgtctcctggtgggacggattgggccatggcgacttgttggaagagtgtgaaaactcagactgaagattatggcaaaaccttctctatttatgcaaatccttatcactgtctagatctcaaagttcataaagttcatacgttggattttacttgaattaatttatttttttgtttttcacaaaatgtttgtagttttgttgctctcggcgagttaccacgtaacatgattcttcttcccatttttaaagtaatttcatcattttttatattttttacaagcaaatcccaccaatttgaaaagtcttataatactttttggaatgttttagaatacctttttcattacaattaatcaataggcgatttctggaa