Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F27C1.7   

sjj_F27C1.7 RNAi JA:F27C1.7
Simmer:F27C1.7:Screen_A
Simmer:F27C1.7:Screen_B
PCR_productsjj_F27C1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF27C1.7b Source_evidenceePCR669WS150 Sequence/Annotation Release
Overlaps_Gene F27C1.7 Source_evidenceePCR697WS150 Sequence/Annotation Release
Chunk_score Abs_score550
Max_abs_score550F27C1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54287985429879
Overlaps_transcript (5)
WB_DNA_textsjj_F27C1.71082ggcatccttgtatttcttgacacgggaagcgatcgacagatcgacgtacttgtctccgatagtgacaacaagtcctccaagaatcgatggcttgacggcataagtcaccgtgagcttttgtccagactttccgatcttgctaagggcatcagacaatgccttctggtttgatgagctcaattcttcggcggaggtgacctgaaaatgatttttagtttttaaaacggtacgtacgagcatcttcaggattaaaatttagacttgaaaatttccatttctacgtattgaaaacattcgctattcatattttataattttacgaaaacaaatttcaaaagaaacattgtttttcttggcagttataataaaagtacctgaacgaaaagttctccacggtgagcgcgcatgatggattcgaatgaagaaacaactgactcgagcttgttcagacgtccgttctcagccaaaagtcctgaaagttacaattaaatttgtaattacacgttaacaaaataccaaggaagtttccagtctctttggtaagccccaatttagttgagatagcctcgatggcggtcttcttcttgttggccttgagagttgggtcgaggacgaactcttggaacttcttgttgtccttgtacacggagcgaacattgttcagatctgtggaaatctggtcgagcttgttctgtttgtgtccggctgagtaaagagcggcggcgtaacgtccctcgactccatgaacctgaatcggggtcttcaccagctgagccttagcgagagcagcgctcgtggagaatccgcgtttcatgagttgcgccattacctgcaaaattaagaaattaggcaaaatttaaatttaataaatgtatgcaagcaaacgaattaattaaaacaactttttaaatttaattaagaaaaaaataataaagagtggatttttacatactttttcgtgaagaatagtcaaatataggtaaagaggcttgcttgggataaaaattcgcataaaatagtacaaaaacttaactgaaattcgataaaaaagaactgaaagctaatttcaagagaaaaagggc