Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F27C8.6   

sjj_F27C8.6 RNAi (5)
PCR_productsjj_F27C8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F27C8.6 Source_evidenceePCR1071WS150 Sequence/Annotation Release
Chunk_score Abs_score1008
Max_abs_score1008F27C8.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV95876229588809
Overlaps_transcript F27C8.6.1 Source_evidenceePCR1071WS150 Sequence/Annotation Release
F27C8.6.2 Source_evidenceePCR1071WS150 Sequence/Annotation Release
WB_DNA_textsjj_F27C8.61188tccatcaaatcttgggcttcatagctttggctaacttcccatctttccgtaatgctgtgatttttgtagttgtgtttcatttcgatcacgcttttatacgacataatctgaaataaagaataataagataatctatgctttaatcaaaacttttatacctcactggcttctgactgtaagtgatttgcaacgtggccgtttgaaataacactgggtacaagatatgctttttcatccatgtcaattccagcatagaacatgtaataataagcaactgactcaggatcgactaaagcatagccacggaggcgagagtggaagtaacggtatgaaactgtttgcatgtcagccatttgcaaaagtgggtagatgagcacttgtccagccaattttggaaacgagtttcgagcagcacgacgttgagcaatgactgtagccaagtttccaccggcagaatctcccattataacaacttttgacgtattcactccgaattgcacggctccaaaatcgaagaagtgatcaatagcggcttcacaatcgagaattcctccaggaaagacagtttctggtgataggcgatattcaatagaaataaaaagtgttttcatctcatatgccatcctcttgacgagcgagtcatacatgtcgacgtttccaagagcaaaaccacctccgtgaataaaaagaacagctccatcggtagaagttttgttgtttgtcggacgatagactttcaccggggtttcgttccatttgtgccatttaatatctacttgtccatgtgtgttgacgagcagtcccagagttttggaaagcgtatttaaagcaccacgagtccactgaaccatattactaggctttgtgaacatccgactctgaaaaaaataatattgaatttaattttaataactataaaacagaaagggagaataaattcttaccggatagtagtaggcgactcgtagagctggctcgactacatgcataacagctctgtcccatttactaatagtgaatccttcgggaagtggcttatacaaagcgtatccagtgataagtaggaatattgtgatgaggacggggacaatgcccttggtgtagtttgactccttttttgctttgagcatcatagttaggttagtaattgtacagaagattatttacagaaataatggacgaggcgaa