Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F27D4.1   

sjj_F27D4.1 RNAi JA:F27D4.1
Simmer:F27D4.1:Screen_A
Simmer:F27D4.1:Screen_B
PCR_productsjj_F27D4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F27D4.1 Source_evidenceePCR913WS150 Sequence/Annotation Release
Chunk_score Abs_score808
Max_abs_score808F27D4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI77029687704566
F27D4.2 Source_evidenceePCR0WS150 Sequence/Annotation Release
Overlaps_transcript F27D4.1.2 Source_evidenceePCR795WS150 Sequence/Annotation Release
F27D4.2.1 Source_evidenceePCR0WS150 Sequence/Annotation Release
F27D4.2.2 Source_evidenceePCR0WS150 Sequence/Annotation Release
F27D4.1.1 Source_evidenceePCR913WS150 Sequence/Annotation Release
WB_DNA_textsjj_F27D4.11599gcaaaagtgaatggagtgaaaagagttcttgtggctcaagatgagaagctgaagaataatcttccaggtaatataaaccgaattaatttttctattatgctcgtattttcagaacgagtggctccagttattcttgcttctcaaaaacaattcaatttcaccgccatcaccgctggatcttcagcattcggacgtggagttattccaagagtcgccgctaagcttgacgtatcttcaatctctgacgtcactgaagttcattcggctgacagtttcactcgcactttgtatgctggtaatgcagttaaaaaagtgaagagcaccgcaccgatcaagcttctcaccttccgtggaacatcgttcgaaccagcaaaggaaggaggaagcggcgctgttgaaaatggtaacatagaaaatcgttttatccagatgcgaagatgcgaaggattttgctccaagaataaggtacctgctctcgaagcggcagttttactcgaactcgaataagtgtatggcttttaaggggtactgtagtttttacttgttagcggattttctgagattttccgagtttttcttctgtttcttcaaagtttgaaattttaaaatgttaaaaacggacgaaaacttcaaaaaaaaagtcgaagaaaagcttgcaacaaccaactacagtagccctcaaagacgcaaacacattttcatttaagaaaatctgccgcttagagaccgggtgccgtattagagataaaatcgcaaaatatcgcatctgggtaatatatgaaagaaagtacgtaaaaatttgcctgaaaaacgaacccccagaaactggccgagcctacttttcttgtttatttttattttttatgactgagtaggacaattcgagacagttatcccacaattgatagtccacatttaatcctgatctttgtcaaaagtctttattcagccccatccgctgatatcaaaaccgacctcagcgaattccttggccaagaattgagcaagtctgaacgtcctgatcttgcaactgccaaagtcgtcgtttctggaggacgtggattgaagagtggagacaatttcaagctcatctatgatcttgctgataagctcggagccggagtcggagcatcccgtgccgctgttgatgctggatacgtaccaaatgacatgcaagtcggtcagactggaaagattgtagcgccggtaagaaatccattaagtgagaagcaaagaaaaatgaattaatttataggaactctacattgcaatcggaatttctggagccattcaacatttggctggaatgaaggactcaaaggtgattgtcgccatcaacaaggatcctgatgcaccaattttccaggtaaaaattgaatttaacacaaaattgttaattctaaataattcaggtcgctgatattggattgaaagccgatttgttcaaggccgtcccagaactgactgctgctcttccatgaataccttcaaatagcctaatgtagatgtgtcttctaaattattgtattctatttagtaactcggtttatcgggatattgtgattttcgtttttatgctttcaatgtgaataaacagcc