Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F27D4.6   

sjj_F27D4.6RNAiJA:F27D4.6
PCR_productsjj_F27D4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F27D4.6 Source_evidenceePCR836WS150 Sequence/Annotation Release
Chunk_score Abs_score693
Max_abs_score693F27D4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI77341167735231
Overlaps_transcript F27D4.6.2 Source_evidenceePCR836WS150 Sequence/Annotation Release
F27D4.6.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
F27D4.6.3 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textsjj_F27D4.61116ttgttgactggaaatgcgaattctgcagcacaaaacagaaaccattggagttctccacagaattcgatgccatccgacatgttatttcaagtcagaaacataaggaatatgtgagaatttaagaaacatgccatacatatataaattccccacttttcagatgaagttcactgcaccaattcacgatctaaatttctggtataactggattgctgacttgaatcgcgtgaaaactgtgcaaactgttaatctaacaccaaagaattcaagaacagaacaatcacacaaattcttgaaaaaacccgaaaacatgattattcctgcaagtaagtacaacaattacttacaagggaagtatgcatttgaattcgactacaaggaaaatcgatctgaagttttttctgtgaagtgttttactactattcagatttttattccagtgctccaaaagttgactttacagacgttctcattaaaaaaaatgcaggaaaagttgttccaaaaatttatgtttgtcctaatttttagatgtttcaagagctccattacttgaccaattagtttctggcattgcagttgtaaaaggtatggttcatttgtggtcatgtttttcaatttattcttatttttaaggtaaagaattcaacgacaaaataaatgaattattgaccctgattaaatcaaaaagttccgaggaaaaagccaaaaatacggtaaaattattccagatttgcaattaaaaacgagcatttttttagcgagtaaactggaaatgtacattttgtgtgaatttgcattcaaatcaaattcgtatgggtaacatgagtagtgcaattcgacatattttttcttttgatcatcgacaaaatgtgagaattcacaataatttaatttttatttgaaaatatttcagatgggttgtgttgcttcttcgtctgatctcaatttttggaaatcatttttaacagttgcggttacaaaagaaataccggtgatcactccgcaagtacaaaacactacaagttctccaattgcacaaaatgttaaaaaaagtaggttcccagaatgcacaattatattttaaatcaacaaatttcagacgaagatcgtatcgca