Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28B3.1   

sjj_F28B3.1 RNAi JA:F28B3.1
Simmer:F28B3.1:Screen_A
Simmer:F28B3.1:Screen_B
PCR_productsjj_F28B3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF28B3.1 Source_evidenceePCR996WS150 Sequence/Annotation Release
Overlaps_Gene F28B3.1 Source_evidenceePCR996WS150 Sequence/Annotation Release
Chunk_score Abs_score954
Max_abs_score954F28B3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI49476754948774
Overlaps_transcriptF28B3.1 Source_evidenceePCR996WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28B3.11100gttgttgtgtgtgctccaccatattctggtatatctctggttctctggtgcttgtcatcggtatattctgggcatcataccaccttaattccaccaatggaagtcgaacaacagccatcactattcttgacgactctatcaaatctgaaagttcgtgatgcgttcaccacatactccaccatcaacacatgtgtgacacagctggcgacatcagtcgagaatcttcgcgaacgtggatgtaacctgtcgatgctcagaagttgtgtggcgattgccgaagaacgacccaggattgctctgatgagctcattctgcaagctgtttgctcctcttgcactcaacaatcgtgcaatctctacctcattctcatcacgtgtaaacgctgccatctgtatgcaaggagcatctggaccggagccatcaactgtctacgtggatgcaagagctcttcgaaatgatcgtatctcgctggtcggaaaaggagcaccgcatagtgtggcactgattgaaagtggaaagcttctcccgggcgtcaaaattgccattgctaatccagaaacgagagggcaatgcgcagattctcatctcggagaaatttgggtggcgagtattcacaacgcatccccattaaatcgtttggcaagtgtcactgggttcggagacgaaggaacgatgaatacggatgtctataatgctcgtttgacgactggagacacaaagactcgatgggctcggacgggatacctgggtttccttcgacaaactcaatcgatcaccgagcatggagagcttcatgatgcagtttttgttgttggagctctcaatgagagtttggttcttcgtggtatgagatatcatccatttgatgtggagagtactgttagcaaagcgcatcgttttgttggaaattcgtaagtttttattgagatttttttgtgaaataaaaaatgttgcaaatgttcatagggaaaaatacggtaaatgtgtctgcattcactgactcctcttttttcagagccgtcttcacatggaatcaccttgtcgttattgccgccgaatgtactggctccgagtcggatgctctcgatctcgtaccagcc