Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28B3.5   

sjj_F28B3.5 RNAi JA:F28B3.5
[cgc5659]:f28b3.5
PCR_productsjj_F28B3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F28B3.5a Source_evidenceePCR752WS150 Sequence/Annotation Release
F28B3.5b Source_evidenceePCR752WS150 Sequence/Annotation Release
Overlaps_Gene F28B3.5 Source_evidenceePCR837WS150 Sequence/Annotation Release
Chunk_score Abs_score753
Max_abs_score753F28B3.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI49264804927628
Overlaps_transcript F28B3.5b Source_evidenceePCR752WS150 Sequence/Annotation Release
F28B3.5a Source_evidenceePCR837WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28B3.51149tcgaaaaagtaaattgcgccgaaaatttcatgaagagacgcagagaaaacgactgttataggagcattgtcgcgccgagacactcattttcaaattcgttgtatttctcttccataacagattttcaatggagcgtacatgcattatttcatttttcttcattttttttgctgtattttgctgttttttcatggaaatctgttcaaattcctgtaaaattaatagtttgaagaaagaaatatacgaatttaataatgagaagttccctattatcaatcggactctcacagttcggattaagtgttctgcaggtgagagtttcgtatcctaaattctcaaaaagctcaattttcagacgctcttcatgttttattatgttaaagtatacattaatcagtttcacgtcaacacaaaatggttcaacattgcgcaaactttgtttatggtctggaatgcaataaatgatccactttttggatatttgcaggtatttgttatatttgtaagctagaaatgattatttaatattttgttttcaggaaattcgtggatcatggctcacaaatcgcttattagtgatcaaaactttatctcctttccttgttggctcatttgtgttcatgtggatcccatggaatacagaaggttcagatttggaaggattgcaccttgttctctcattattcctttacgatgcattcttcagtgcaatcagtgttgcatggggagctctattcgctgacaccacacaaaatcagtcattgatccgagtaaaagcactgaaatattctcaaatcgcaattcttttatcggtattttcgattgctgtcacggaaaagctgagcaacagtttaaaggtattattatttaaaatttagatttaagaaatgttcgctaatttcagaattttccgattttccaaggaatctgctttttcgtcgcaatactttctttcatttgtctttggtggggaggtcactttggaaaaatcacaaacaatcgtcaagaggataaggaacaaggagatcgagaagttttaattgaaaaagaacaagaaaaagaaaaggaacatcaactaacattccacgaaaatgttcaaaattctattcatcttaccaagcaaattctctcacaacgacagtttctcgc