Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28C1.3   

sjj_F28C1.3RNAiJA:F28C1.3
PCR_productsjj_F28C1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F28C1.3a Source_evidenceePCR818WS150 Sequence/Annotation Release
F28C1.3b Source_evidenceePCR818WS150 Sequence/Annotation Release
Overlaps_Gene F28C1.3 Source_evidenceePCR818WS150 Sequence/Annotation Release
Chunk_score Abs_score776
Max_abs_score776F28C1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1247376112474740
Overlaps_transcript F28C1.3a Source_evidenceePCR818WS150 Sequence/Annotation Release
F28C1.3b Source_evidenceePCR818WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28C1.3980gagttcgagcgatacttccgtgagattcaaacatattgtgatcgaaacaaggatgatgtgctcaagaggttgaccgtgacatttgatgatgaggaaggtgattctggtgttgagaagaaagatggcaatgaatgtgaaggtgaagataacaaagatcgacaaggtatggttatttcttattctatttttgccaataaaaatttgaaaaatatatttcgtcaaatattcgtcgaatcaccggatctattatatatttaaatcaaaagtacatatatttccaatcatgataaataatttctcagtagtgatttaattttattttcagatactccagcagaaacagaaaatggtgtttcttcaaatgaatcgaagttagaaaatgaggaagttggagtgtcaaagcctgaaagtaataacaacgaaaaaagtccactaatggcatcttcatccacatcaaaactatctcgaaaagagagacatcagcgattcgtgagaagctcttctctgacatgtaccgagacagttcatgatattcatgaccggctccgcgaaatgtcgggatccacgcattctttggatgcagcaattgcagcggccgcctctaattctacaatgcaaaatctgttgactgtttcatatggttccaatcctggacccctggattcatctagtaattcggaatcaatgaaaacaataaagaagtcattcactgttactgcagcatcttcatcttcacttccactggcagaatggggatccttgcctgctttaccacaagcaagtccatcctcaactccagttgtgaggaagcttcgacgtttctccgtttcaccctcttcaagcgtttttgatgtagccacaacatcttcggcagcctcgtcgacagcttcatcgccgatcccagaaaattctattgcacttcccgttcgtccttcgaccttggccataggaataccaattattggaagtgttccagcagg