Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28C6.7a   

sjj_F28C6.7a RNAi JA:F28C6.7a
Simmer:F28C6.7a
PCR_productsjj_F28C6.7a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F28C6.7b Source_evidenceePCR321WS150 Sequence/Annotation Release
F28C6.7c Source_evidenceePCR330WS150 Sequence/Annotation Release
Overlaps_Gene F28C6.7 Source_evidenceePCR505WS150 Sequence/Annotation Release
Chunk_score Abs_score379
Max_abs_score379F28C6.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII86024908603659
Overlaps_transcript F28C6.7a.2 Source_evidenceePCR470WS150 Sequence/Annotation Release
F28C6.7b Source_evidenceePCR505WS150 Sequence/Annotation Release
F28C6.7c Source_evidenceePCR474WS150 Sequence/Annotation Release
F28C6.7a.1 Source_evidenceePCR472WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28C6.7a1170aaattttcctcgacgtttttctcactggcctaaatttttttaggaattttgtcggtattttttattttcaagcatgtaattgtctctaacattaatgagttttcaacctgcatgtgtgctctccttgtaattcgagaatattttttattctcgaatttgaattatactttctaccaccgtaattttattattgttacataatataatatttattttttcaggtaataatgaaggtcaatccgttcgtctccagcgattccggaaagagccgcaaggcccacttcaacgctccatcccacgagcgcagacgcatcatgtctgccccactcaccaaggagctccgcaccaagcacggaatccgtgctattccaatcaggttggtttttttaaatagaaaaactttactgtttccattaagtagtcccgtacgttgaaattttcacgtacggtttggacaatatggagaaatgaatgttactctttttgcaatgacgctgaaacatattttcgctttgttagccataagtttaaaacaatttttgatttcagaaccgatgatgaggtcgtcgttatgcgcggacgccataagggaaacactggacgtgtcctcagatgctaccgtaagaagttcgttatccacatcgacaagatcacccgcgagaaggctaacggatccactgtgcacatcggaatccacccttcgaaggtgaggtttgtataaactagttccggtgcacatcgactcatcacaactgtcaggtttgtgagttccatgattcttaatgttgcattcggactaggaaaagtttattatattttgaagtgaccgagttcgttctttaacccaaattatgttcaggtcgctatcaccaagctgaagctcgataaggatcgtcgtgccctcgttgagcgcaaggctgccggacgttcccgcgtcactggaatcctcaagggaaagcacactgacgagaccgtcaactaaattgttattaattacaaataaattgttgattcttttccatttgttttggcttcgattcattttcaaagaaaatattttaatgctatctggaaattccagtaataagtaaacaagagtaatagtacagaaaaagctatttaaagggtcttctatccatttgagaaaatgtatctgatgttttggcgagt