Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28C6.9   

sjj_F28C6.9 RNAi JA:F28C6.9
Simmer:F28C6.9:Repeat_a
Simmer:F28C6.9:Repeat_b
Simmer:F28C6.9:Screen
PCR_productsjj_F28C6.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF28C6.9 Source_evidenceePCR764WS150 Sequence/Annotation Release
Overlaps_Gene F28C6.9 Source_evidenceePCR764WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII86087928609800
Overlaps_transcriptF28C6.9 Source_evidenceePCR764WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28C6.91009tgtctgtttcaatctgcccattccgattgaactccaattgcgcggagctgaaaatagttattgaattagaacaaaaatcatcactacttcatctctatccaacagcaaatcaacgtgaactgctcggaatactgtatctctacaatcaatcattgccagtcgatgacgttcggcctgaaaatgttctatccaaattttaattgtgatatgtctataaactaaccatattcagatccccaacttctaaagctttacttcttctagttgccaaatcttcaatccttgcttcatactcgtcaattcgttgaattgcccgaagacaaacagttgcttgaattgtctttccatcgaaatttgccttttccattttttgttccaaaactcttcgaattgtacgaactgatgtaagtggatctccacttagattcgtttcttctttcattgacatcccgtcaccttcactaaaaacttttgatataacccgatgagatcttcactataaactaactagctatgtctttccactttaacatttcttttcgatgatggtctgctgttgtgttcaggcacctgttttaccggctcatccgcgtggatttcctctatttccggctccatttgccgtaccatctcatctgacaatgggtaccctaaaactgttagcttccgaatttcaacttgtccgtgtggattttgtgataatggaatgggtttgtcaattgttatccagatgtattgaccaattgcatcagtgaaagcatgtctaaatttatctttgaagaaaaaaaacaaatgaaaaatttacaaacttgctctccagtcgactagcagatcgttctcgtctatgaaattccagcgagaccggcttttgatacttggcaattcttgcatttttataattaactaatgtgtccaactcgccctttccaacacgaatagtaactcgtgatgctgaaaataaaaatatatgctatatttgattgggaagtgcagacatacgcgtaaacga