Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28D1.1   

sjj_F28D1.1 RNAi (3)
PCR_productsjj_F28D1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F28D1.1 Source_evidenceePCR775WS150 Sequence/Annotation Release
Chunk_score Abs_score712
Max_abs_score712F28D1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1237223812373325
Overlaps_transcript F28D1.1.1 Source_evidenceePCR775WS150 Sequence/Annotation Release
F28D1.1.2 Source_evidenceePCR775WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28D1.11088aagatccaagccagatggtggagtcaagaaaatctcgatcacggctaccgatgtcacacctgcaaagggtgtggaggagaaaatgagctggaaagagtataaaaagatgaagcagcatactggcggtggaacacgaaataagttaaagaagaagcagaggcctccaactgagaatacagaaggaagagctaaaaagccaaaagtgttaacaaaagagcagcttgaacgacatgatacaggagcagaccaaattgatccatcttcgatgcgttcaaagcttcaacaggaaaaaatgaaagtgacgaaggacaagtttcagagaagaattgaagctaccgctaaagccgagaaacgtcttgttgaaaatgtgagttgttccattgctactcaaatattcacaaaatataatttcagaccggattcgtagcccccgacgaggaggatcactcgctgacctacagcatccgacagaaagatatcgctgaatcagttgatttggctgcagccacaaaacatttcgagttgaaattgccacgattcggaccatatcacattgattatacggataatggaaggcatttagtgattggaggacgaaaaggacatttggcagcacttgattggcaaaccaagcatcttcattttgagcaaagtgtgatggagaaggtttccgatgtgaagtaggttatggcgtccaaatttctaaaactgttttacgctgagacctctttttttcgctgattgaagtgcttttttgtgcctataagtcacacaataccaccgaatttgggcaaaatgcacctcaatcaacttaataaaagcgtattttgttaaaaggaaattttcaagatgattttgtaaaaaattcggtagctttagaacatatggatgctaattacacgtttaattacatttgttaaacattaataacaacgattaatttcagatttcttcatacggaaaacttcatcgcagtcgcccaaaaaaactatacttatgtatacgacaacttgggtacagaacttcattgcctgaaaaccatgtacgacacagctcgcctcgaatttcttccccatcattttctgctc