Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28D1.10   

sjj_F28D1.10 RNAi JA:F28D1.10
Simmer:F28D1.10
PCR_productsjj_F28D1.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF28D1.10 Source_evidenceePCR944WS150 Sequence/Annotation Release
Overlaps_Gene F28D1.10 Source_evidenceePCR944WS150 Sequence/Annotation Release
Chunk_score Abs_score881
Max_abs_score881F28D1.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1240736212408403
Overlaps_transcriptF28D1.10 Source_evidenceePCR944WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28D1.101042tcatgcccgatcattattcagatcctcaagaattgagagcattggttcaaattatcggaccttatggagtaaagttgatgactgaacggctgatttggcacgtggccagtcaaattatggagatgagcaagattgttgcaacatacaaagatgctctacagattgctagatctaatttcgataatgctgaaaagatgaaggatgttttaaatcttttgagcgtcgaaccaaaggacaagaaaactccgaacgcaacatgcgcagctgatgcaattctgcaaagaactattattatcggacagatttgtctgtttcgtgatgctctccacgatgctcttcgtcatatcgtcgaatctaaattgccatttcttcaagcatcatttgatatgctttatcacaatttggacgatgttgataaagttaaaattggagaaatgtcagctgcgatgggagtcacaggaccagttgatatgtcgttggtgaatgcggttcgtgctcaaaatccgaatattcaccctcaagaacactatgttaatagttgtctattgatggttgccgtcgctatctgtattccacgaattggaatgtcggatctttcgtcttacaagcctagcattcaaggtacatacttttacagctttttgcaaaaattaaaaataaacaatttcagccagcttgaacaatagtcactgtgttccaatggcgattaacactatcggatcagctcttttccatctccacgagcaaaatgatatccagtcgaggatgaaggagttcttggcggttagctctatcattattaacacatattctcacctagaaaaattttcagctcgcgtcctcgggtattctacgaactattcatgaacgtgataacagtcgacaaatatccgacgacgttcttcgttcccacacaactctctacattatccttgaacagatggttcggaaaaaccgttggctgtcgatggatgttcttgaaacctgtttcccatataatctcgtccgtacagcctaccaacaatgctacgaggctgatgct