Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28D1.7   

sjj_F28D1.7 RNAi JA:F28D1.7
Simmer:F28D1.7
PCR_productsjj_F28D1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F28D1.7 Source_evidenceePCR530WS150 Sequence/Annotation Release
Chunk_score Abs_score467
Max_abs_score467F28D1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1239016612391278
Overlaps_transcript F28D1.7.2 Source_evidenceePCR499WS150 Sequence/Annotation Release
F28D1.7.1 Source_evidenceePCR530WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28D1.71113atctaacacgactcccaatctcaattttccatgttcagttcacgcctcattttcaattagaggttgtaaattttatgcaattgtaagaaaaatcatatgggttaaccccaacaactttatgtcggaataacaagaacaacaaacatttacgaacgtggtctctccttctttcccttgaacagggcgatgagggaggtgttggcgaccttcacgatcttgaaacgaactccgggaatatctccgacggcgtgaccggaacgtccgaaaccagatacgagcacttcgtcgttttcctggaaaataataattgatttttttaattaaataaattttgtcagaaacggaggtgaaacagatgagcataacgcaagaactgtttgcataaagtacctaattcattttcgagcaatcctagcaccgaagagatacatattctcagaggtgactctggacctcgtatagattgagttattcaaaaaaaacaactcacttcaacaaagttcaagcaaccgtcatttgggacgaaggcggtgatcttctttccgttcttgatgagctggacacgaacgcacttgcggatagcagagttaggctgcttagcttcgacaccgctgaaaattatgaatttgaaatcttaacttcacgcttacagctaaaatcgaaaattaaaatcttataaaaagctcacatcttttcaagaacgattcccttggcgtgagaagctcctccgaatgggttagacttccagcgagttccaatgtgagccttcttgtatctcttatcgttccatctttgctcttgacgatgagtcttgagcttgcgagccgtgcagagtcccttcggctttcccatattacctagaataaaaatgtaaattacaaggacaaattttatatttcgaacggatatggcgataaaacgaataatgcaacaaaacccataaacaaatatatgagaaacaagctttttagaccaattatatgttgttattttcaaaatttcagcgaaaaaaagttgaattcagcagaaaaagccaaaaaaattttaggattcggggaaaaattcaacggttctggtgaagagaaggcatgaacagctgaaacgagtgttacc