Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28D9.2   

sjj_F28D9.2RNAiJA:F28D9.2
PCR_productsjj_F28D9.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F28D9.2a Source_evidenceePCR624WS150 Sequence/Annotation Release
F28D9.2b Source_evidenceePCR672WS150 Sequence/Annotation Release
Overlaps_Gene F28D9.2 Source_evidenceePCR676WS150 Sequence/Annotation Release
Chunk_score Abs_score571
Specificity_index0.146
Rel_score0.171
Map_statusUnique_ePCRI1118470011186334
F47H4.12 Chunk_score Abs_score2789
Max_abs_score2789F47H4.12
Specificity_index0.854
Rel_score1
Overlaps_transcript F28D9.2b Source_evidenceePCR676WS150 Sequence/Annotation Release
F28D9.2a Source_evidenceePCR624WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28D9.21635tcaatccaatatctggtaatcgcaacgtgtcacactttcccatttgtcaccgcgatttgcttgctaaaatcagagctgagccacgtgcagcaagttaggattctggagaaggtgaggcgctacaaactacaaactagagagactgcaaactacacccagaattggcccaattgcctgcacatcctagatcaccgcggattcgtcatgtacgatccgtttgacaacccgtggaccactgcagtcggcctttctgcgatggtttatatttcggtttttacgttgtaagtctggaatttcacgtgatctacaaaaaatgcgggaactttggcgcccaagagtctgcgtccaagttcccgcaattcttgtagatcaaactttttcacttgtttctcaggcctatagttaacccaattttccagatttggagcctatgtcggattccataccgtatatatcctgcagaaggtcaaacctcacctatcaccgcagacctacgccgggcacaagaacgcaatgattaatttagtgatgcagtgtgttgtacctattgtatgcgttattacgccgttcaacttgattttcctagtggtttactatgatttgtggcagtatcaacgtaatttttttttacagttgaaattttggtctccccataaggagtctgatctacaaaaaatgcgggaaatttttcccccagaaaaacatgccgtcagcacactcctaaccatgcaaaatcagttgagaactctgcgtctcttctcccgccttttttgtagatcaaaccaaaatgagacacattggcaccaagtgcctttcccgttgcatttctcgcgctccattggcaatcgcctgccggacagcgcgtgggaaagtcgtgtactccacacgaacaaatacgccgcggccgtggccgaatccaaatggcctaattcgacgaactcttacattacggggttctggccttcctcgttgcatttttcgcgctccattgacaaccgtctgccggacagaacgtgggaaagttgtgtactcctcacggacaaatacatttagttttacaacaaaaacctagccgcgacgcgacacgcaacgcgccgcaaatcgaccccggtcgtggccaaatttacatgacctaattagacctcttccatgtcgaaaacggaaaaaaattcacaaattccagaatccgccacaaatttattcttcctaatgtcagctcaatctatggctacatcacttgtaattattctatcgaaccggagattcaaaagattaattttggagaagcttttgatcatgttagctggcttcaaatcttgtaaagctcaattaattttattttcagaccgtacaaaattgcggagacctttacaccgcccagtttgcatgtgtatcagtcgtctacgagggtcgcgccgtcttaattcgggatttaaatgtttttttttaatatttaaataaatgtatgcacatatataaaaggagtttctgtctgtatttttgattttaatatatttttcccaaaaaacttaaaatttaattaacctttgcctattaaaatatttgaaactcgtttttttccggttgaaattgaaattacggcaaaattcgagtgtcaggttgtccaattaccat