Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28H1.1   

sjj_F28H1.1RNAiJA:F28H1.1
PCR_productsjj_F28H1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF28H1.1 Source_evidenceePCR666WS150 Sequence/Annotation Release
Overlaps_Gene F28H1.1 Source_evidenceePCR673WS150 Sequence/Annotation Release
Chunk_score Abs_score652
Max_abs_score652F28H1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39954313996463
Overlaps_transcriptF28H1.1 Source_evidenceePCR673WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28H1.11033gaaattcttgcattatttggctggattttttccgctcggaattacacacttcgtcttgccacataatgtataaatattatcgatcgaaataacatgaaataccgatcaataacactgaatatacattctttattgctatctccattaggcaatctcttgcaacatttctgaaactaaatttctcaattcaatttcttcattgttctacggagttattttcaacgtttcaatcttttatctttccttttcaaaattttcctcaacttctgaattattccagatccccagtccatcaaatggctcatcgaatgcatattggccaattcacgagacaatatccagcggagacagccttcaaagtccagtcaaacccatggaagaactctccagaaccatttcttccaatgagcacccaacagccaaagtcttgggcagatgttggaaaggttgcaggacccccaagaaactaccatcatccatatgaagtcaaaccatttgaggcgattgatgagaagaatgatgtgttcagtactatgggtcattggaattctgagcagaagcagagtcgacaacagcatcagcaataccagcagaaccagtatcaagcccgtcaacatcagtactatcagaacccacctccattctaccaaccggagcagcctgtgcactatcaatctgctcagcaggatgtctttgataacattggcgaatgggacaatagcactccaatcccatcgcaaatttctccacttcaactggatcttaccttgaccactccacttccaaccttccaaccatatccatcaactcgttcatattccttggagtctccaaccacatcggtcacttcaaatgaggagaagaacagctggaagacgatcgaattaatcctcaaccaaaagtcgagccgttcgccatctatcaccgaacgtctcagcccggtggactttggaccatggacctcaaacttgtaaattctgaacaatatcccgatctcctttcctttactactcggttactatacacaaacggc