Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28H7.10   

sjj_F28H7.10RNAiJA:F28H7.10
PCR_productsjj_F28H7.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF28H7.10 Source_evidenceePCR724WS150 Sequence/Annotation Release
Overlaps_Gene F28H7.10 Source_evidenceePCR724WS150 Sequence/Annotation Release
Chunk_score Abs_score661
Max_abs_score661F28H7.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1077002510771021
Overlaps_transcriptF28H7.10 Source_evidenceePCR724WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28H7.10997gcaattccatttgttggacctttcgttttaatggtttatacaataatagcaacagatcttgtcagatttgcaatgatttattctatatttctagttggtttctctcaatgtaagttgatgtttgaaaggtggagtagcaaagagaaaatctatttttagtgtgaatataatcaaatatcatagttaaacaaaaaaaatttcaataatttggcaatttgccaaaacgttgactgacagattcacttataagaaaaatttgcagctttttacttgatttttacttcttgtgaacgtgactctactgcaatcaagaaaattgatcctatgggttcggagttcaataatattatggaaaaccctgttgatgctcttcttcgtacatttatcatgacaattggagagttttctgttctttatcgtgaaatgtcagcttgtgataatttctggatgaaatggatcgggaaacttatattcgtaatctttgagacatttgtatcaattctccaattcaatttgcttattgccatgatgactagaacttatgaaacaatatttttgacacgaaaggagtggaaaaggcaatgggctcaagtcattctaatgttggaaatgggattatcacctgcaagtcggaagatgcatttacttagatatacaagaccaactggtatcaataaaagagttagaagttatgttgtggtatctaaaggagaaggtgaaagaactgaaaagaacgaattagctgcgagagaagcaaaagaagaacagaaaagagaagagagaagacagttgttaaagaagaaacaaagagtaattttattattttaaaatctagtagtttttgataattactgcggaagcaagtcatatttcttatctgattcaaacttttacaactttcaggaacacgaagtgaaggcaaaggcactggcaatgatgagtgccaaactccacattgaggtcaaaaaacgaagaattctcaggcagcaaactgttg