Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F29C12.4   

sjj_F29C12.4 RNAi JA:F29C12.4
Simmer:F29C12.4
PCR_productsjj_F29C12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF29C12.4 Source_evidenceePCR861WS150 Sequence/Annotation Release
Overlaps_Gene F29C12.4 Source_evidenceePCR871WS150 Sequence/Annotation Release
Chunk_score Abs_score808
Max_abs_score808F29C12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1311728513118482
Overlaps_transcriptF29C12.4 Source_evidenceePCR871WS150 Sequence/Annotation Release
WB_DNA_textsjj_F29C12.41198aacgttttaaatgcacttttccaatattatttttattttaaaaatttaaaaattatttaagtgaaaatctttgaaaatttaacatctaaacttcaggtaatacacaatgagtcctctcgggaggttctctgcagtggcgcaaagccgtcggcaggtaatttatttatttttaaattattttaatagttttttttaaatgaatttttcagctaaacaacgtcctccgacgattcgcatccaacgaagcgccgtcgtccgtcgtcgtaccaggagtccggccaattgaacgaatcagaaatattggtttggcgtttaatcctaatttttgatcaaaatcttgatttaaaacacaaatttccaggtatttctgctcatattgattcgggaaagacgactgtcacagaaagaatcttgtattatgccggaagaatcgactcgatgcacgaagttcgcggaaaagacgacgtcggagccacaatggattttatggatctcgaacgacagcgggggatcactattcagtcggcggctacctatgtggattggcacggaactaatattaatattattgatacaccaggccacgtggatttcacagttgaagtcgagcgggctcttcgtgttctcgatggagccgtacttgttctgtgcggagttggaggtgtccagtcgcaaacgttcactgttaatcgtcaactggctcgctacaatgttccgttcatctgtttcgtgaataaaatggatcggaatggagcgactcctctgaaagctctagatggcctccggaataaattgaaccataacgcggcgctcattcatttaccaattgggaaagactcaaatttcaatggaatcgtcgatttggtagaaggacacgcgttgtattatgagggtgaaggtggacttattgtgagaaaggacgagattccaaaggatttgagggtggaagcagaagatagacgtcaggagctcattgagcatattgccaatgttgatgagactcttggagaaatgttcttgaacgatcagacgccaaatgttcaacagattcatgaagctattagaagaactgttgtcaaggttgaataattattaaagcgcgcttgctatcagattattcagatttactcgtggtgctaatatgtcccattacggtttgatctacaaaaaatgcgggaataaaaatgcacaaaaccaa