Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F29D10.1   

sjj_F29D10.1RNAiJA:F29D10.1
PCR_productsjj_F29D10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF29D10.1 Source_evidenceePCR447WS150 Sequence/Annotation Release
Overlaps_Gene F29D10.1 Source_evidenceePCR447WS150 Sequence/Annotation Release
Chunk_score Abs_score405
Max_abs_score405F29D10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI88402628841406
Overlaps_transcriptF29D10.1 Source_evidenceePCR447WS150 Sequence/Annotation Release
WB_DNA_textsjj_F29D10.11145gatcaaaccgagagagactctgacaccacgtgtaactgtggaatagcaccagttgtgatttctggctcattctgttccactcagtaatattagtgagaaaactctagaagtaccctgtatgaggaggggtctattattgatttttcttatgtattgctatttagatgtataccagaacggtatgactgaaaaaaataatgatgtttgtgtgtgaaatatagatgaaataaagtgctggtggtacgatacaagaaaaatctataataggccttgtctctatatggatatttttgtgtttttcaatctattatgcatctaaatacttctcggaatttttcgtcaatagaacagagcaaggaaaaaatggcacaaatgattgagcactttgaaatttttgttttgtgtaaaataacttttacacttttcagaataacttttgcgattatcgtattgctatcattttcattttcacttcttgtgatttgtgtgaaaaagaagacaaaaaaggaaaaacaccctgactctccacccactttggtaacaccaccaccacagggagccaaattgtcttggaaaggacgacagaagccgttggttgtatttgatgaaaagctatcggaccagtctaaaaaagaaaaaagtgtaagtataacagttataatttttatttccaatatctcccattttcaggtgaaaatcccaaaaactgtagaggagtcggagaagatagtgaaagtcaagaaagttccatcttcccaaaaagtttgtgattcgtcagcatctagtaagaaacgaaagtcgcctaaaaagaagagtgaagatgtggatgaactgaaaactgaaactgaacgggaataatgtgaactttttgcataataaattaatttttgaaagttaattgaaaacaggtggtacaccagaataaatcgggcgttttgaaaaaagtaatttcaatcaaagaaataactattatctgtgatcacagttaatttacgatgtgcccaccagtacactcgcagggtttcgatccagggcatgaaagcaagaaggcagacacgtaggcgtgatcttcaaaacttaagccttcatttcaaaacttaagcatctcaaaatcgaataatcgtcttcacctgagtcgaaagaaa