Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F29D10.2   

sjj_F29D10.2RNAiJA:F29D10.2
PCR_productsjj_F29D10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF29D10.2 Source_evidenceePCR450WS150 Sequence/Annotation Release
Overlaps_Gene F29D10.2 Source_evidenceePCR464WS150 Sequence/Annotation Release
Chunk_score Abs_score401
Max_abs_score401F29D10.2
Specificity_index0.841
Rel_score1
Map_statusUnique_ePCRI88416898842553
C06A1.6 Chunk_score Abs_score76
Specificity_index0.159
Rel_score0.19
Overlaps_transcriptF29D10.2 Source_evidenceePCR464WS150 Sequence/Annotation Release
WB_DNA_textsjj_F29D10.2865acgacaaacacgtaagaacgaatatataatagatggaaattgagagtttatatcgaaaactaataatttaaaatgagtaagattgtactcttggccctcttcgctgttattaccatttcacaggtatcagtacattgtataaatataaacaaaaccaatacatatttaggttgaatcaggagtgttgccagtatcaacaacagaaataactttagtttcatctgaaacatcaattatcgaatcatctcgtgttaaaaggaatggaggctgttgtggatgttgtggatgtggaggaggtggtggaggatgtggatgttgttgttgtagaccaagatgctgttgctgttgtagacctaaatgttgttgtacttgttgtagaacttgttgctgtactcgatgttgtacttgctgcagaccatgctgttgtggatgtggttagttttcagttcatcaatccgtttatttttattttttacaggttgcggatgtggttgtggatgctgtggatgtggaggtggaggtcgtaagcgtcgttcccttcaaaaacttcgaattgatgaagccaatcgtgcacttgggattaaaaaaagaccatctaatgacaaatgttagtccaataatctattcaccttttatttattatcatgacagctgataaagttgaaaaactacaaaaaaaaaatattattgtaccctaatgagactctcgataaaatcatgtgtttcaatgtcgccatttcatgtagcaaataatggggctgcttgtttcaatgtttcaaattgcgtcaaattatttgtttattaacttgtattagttacacgcacgaaattaaattaaattagacttgcttcagctaaacaggaa