Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F29G9.3   

sjj_F29G9.3 RNAi (6)
PCR_productsjj_F29G9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF29G9.3 Source_evidenceePCR474WS150 Sequence/Annotation Release
Overlaps_Gene F29G9.3 Source_evidenceePCR532WS150 Sequence/Annotation Release
Chunk_score Abs_score469
Max_abs_score469F29G9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV60204566021397
Overlaps_transcriptF29G9.3 Source_evidenceePCR532WS150 Sequence/Annotation Release
WB_DNA_textsjj_F29G9.3942acgaagccacatgtctgttttattcagaaaatctaatttttcaattgatttttaagtattttcagcgttttaaagtttgcaaacgattgttcatactcttgttttcagtaaacatgatgcaatacatgcttctcttcagtcgccagggcaaactgcggctgcagaaatggtacactgcttaccccgacaaggtaagtgtatttcctattcatatgtgtaatttcacactcaattttcagcaaaagaagaaaatttgccgcgaactcatcactcaaattctggcgagaaaaccgaaaatgtgtgcgttcctcgaatacaaggatttgaaagttgtctacaaacggttcgtattttatattcaaaagtaacaactcccatttcctgtcatgccttaaaattgttccttctgaaaataacttacaagtttataatcaaaatttcttgaaaattatagttacacacctaaatccgaagttattacgttttttattcatgaaaaatattttggcgtcaaatttagttgtttaatagacatttttgtgataaatgaaacaaaaacttaacaattcgttcaatttttaatctcaacaatttcagatacgcgtctctgtatttctgctgcgccatcgaacaaaacgacaacgagctcatcactttggaagtcattcatcgttacgtagaactcctcgacaaatattttggaagtgtttgtgagctggatatcatcttcaacttcgaaaaagcttacttcatactcgacgaatttttactggctggtgaaatccaggaaaccagtaaaaaacaagttttgaaggcgattgctgcccaagatctcattcaagaagaagaaactccacaaggattcttcgaggatcacggtttgggataatgaagataatagtaacataatttattgactttgaaagcttccgtaaataccaa