Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30A10.1   

sjj_F30A10.1 RNAi JA:F30A10.1
Simmer:F30A10.1:Repeat_b
Simmer:F30A10.1:Screen_A
Simmer:F30A10.1:Screen_B
PCR_productsjj_F30A10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF30A10.1 Source_evidenceePCR725WS150 Sequence/Annotation Release
Overlaps_Gene F30A10.1 Source_evidenceePCR780WS150 Sequence/Annotation Release
Chunk_score Abs_score696
Max_abs_score696F30A10.1
Specificity_index1
Rel_score1
Map_statusBest_ePCRI94725479474948
F46A9.5 Source_evidenceePCR86WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRI94725479474948
Overlaps_transcript F30A10.1 Source_evidenceePCR780WS150 Sequence/Annotation Release
F46A9.5.1 Source_evidenceePCR86WS150 Sequence/Annotation Release
WB_DNA_textsjj_F30A10.12402agattctcacacatttcctccaatgaacatcagtgtgtcctttacgtgattgtacatgcctaaaaataaagttgatgagacgatacaaaaaacaaacgatttatgtaaaacattgaaaaaaatataacccgtgaatgtatttaaattctgatatgaaaagttctaatgaagtcaggtgatcgagagacaacgtgttcaaattctgcgaagtttatactcgagtctccatccaaatcagcttcttcaataattcgttcaattataaattcaacttctacatcactcagctcatctcttgttaaacttcgaatcattttactcaaatcatcatgtccaagaagttcatctccatcgtaatctaaaacaatattttgatactaaattaaatattattacgcagacctctaaggaccgctattgcaatataattttatcagatataaatgcaaaatttatgtcatgattgttaaaataacaatatgatataatacaatttatttacgcgagttacagtaacccgttgccggaatggcgagacgttgcgcgtaaattgtggtgaaaattcgcaactatggacgtctacgtaataagaaccatataacttttatggattgttaatatcaaatgattttatgtctaatctcttccttaccataaattctgaaagcatatttcagttttaactggagtggtgccatttccgaaaacactgagaacatgtccaaaaaatcgtcgaatgataaatttccgcgtccgtcttcggagaaaacttcacagattcgtcgtttgaatggattttcctgaaagtttgttattgtatcacatcaagttgatgtggccgatatatagatttttgatatttcccccgaagagtactatggtacccgctctcgtcacgaacaaaatattttcaaatcgcgaaaaaacagtgtaagcctataatacagtgatacagtaaccaattatgcatttttgtatatttgccagcgttttcttctgtcaaaaacattattctcttgaaaaaaaaacttatttaaaatttaaataattgcaaattctatgtaagtgagagaaaaagcgcgggaaacatgaagaaaaatgcgaaataacggatagttgactacggtaattagaggcgcacattcatttgcgcgtgcaaaattatttggccagagtcggtaccgtactttcagaataaaaacgcaataatctgtaacttgaggaaaacattattgatagccacggtaggattactgcattttcccaattttattacgataaagacactttcacttttttgtaaataaaagttgcaaacttagcaatagaagttcaaattgaaaatcaagaatatgtttcaacaaaaaagtcgtacctttaattctggcattttctcaacttcttcaaaagtcagcgttgtaattgcaggccgatttccttgcatatttgttggaactttatgtggattcaatgcataaaaccttttgtatagtcgaattatgtcctttctcgtgaaaaatgtgcaatcctgaaaagagatattctacaaactctcattttgatttatggatggctgccactttgtacacttctttttgagaaaatggacgtgctccgaggaattcaaagaaatgagcgttttgaacgagattcttcgtagcaagatgactttttttcaactaataaaattattaatcaaacaaataaatattttcatttaaatgtgagtgatcgaaaatctgctagaggaagctcctgaaagtgcgaggtggagctcattagcgaaattatgagtattttgagccgacattagggatgcggaatatgttatgcatctttaagtagtactgtagttcttactctttatcaattttcatcagatcttccagtcttttcgagacctgcaactatgtttttgccaaaaattcaaaaattcagcgaataagttaaaaggcattattatttattgtagacaagaaatgatgttttccttgaagattactagtatagtttgaaaattttcaggaattttgatagtttttgaggtaaatggcaaaataatgtaatgcaagtaccattttataattacaattttaatttgagatgtaaatttttaaaataaaaataaaaacatacttgatattcatctaattgttctcttgtaaagactcctccttttgaaaaaaggtttagttctgacaatgaacttgcattgtttcccatctggtcacctgatctgaaatgattacttttagttcaaaagttgtctgaaagtatttgaaaaaaaagtagacactgcctattgttaaaaataaagttttgttcggtgagccccctggccccacggaaatcgaggaggaaatgagaatgggtttggggtggcagacaaaccagaaaatagt