Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30A10.4   

sjj_F30A10.4RNAiJA:F30A10.4
PCR_productsjj_F30A10.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF30A10.4 Source_evidenceePCR794WS150 Sequence/Annotation Release
Overlaps_Gene F30A10.4 Source_evidenceePCR794WS150 Sequence/Annotation Release
Chunk_score Abs_score710
Max_abs_score710F30A10.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94840899485223
Overlaps_transcriptF30A10.4 Source_evidenceePCR794WS150 Sequence/Annotation Release
WB_DNA_textsjj_F30A10.41135caggagccaaaatggtcaattcgaatatttatttttatagctcttttaatttctttttcaattttactaacagtttcctacaaatcaatgatggtaagtaaaataaataaataaaacttggaaaaatcagaacttttcgatattttccaaaataaacttcactaaaacgtaggctgaaaatcagaaaaaatatctgaaaaataataaaaaattttgaaattaaagttcttgtgtccaccaattagcaatgttagccacgccccgcgaaccactgattgaccgatttctttctcataatttcataaatttcagattccgaacaaatttatcgtgagattatctggaaaagagcgcgctcctctgaagcatataacaagaagcatcacgaaattcgcagattattattttacagagtatgcaaaacctacttatgttttgaaattaaaaaaaaaactattcagatctgaaagtcgatatttaaattgtgctagactaatcgacggagatgtggagtccattgacacatatgttaataatggaagaatgaagttagatgaagagaaattatttcaactttcaatggattgtgattcaattcaaaatcgtatttttcgagatatgcctccatttgaaaaattgaaaagacctattgcatttgttcgaaatatctatggaatatatgaattacaagaggtttttctatccatttcatatcacccggataactatttctgttatgcaatggattcaaaaagtagtgaaaaattgaagaaatctatgagaataatggctgattgctttgaaaatgtgattgtgttggataaagaatatgatatggatagagctggtcataaacaagatgctgcacattttgattgtttaaaacaaattcttgatgaacattggagtcatgccattacattacaggtaaaaaaatattttcttgaaattctgaattgttcttcttttcagttttctttctttaaaaatattattttcagaacttcgacttgataatcaaatctcctaaacaactatctgatctcagtgaaattctaaattacaccagtatcatgggttttgactatggatttacaagtagatatcgaacatttgaagattggactccagctgg