Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30A10.5   

sjj_F30A10.5 RNAi JA:F30A10.5
PF:GL1_7H4
PCR_productsjj_F30A10.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F30A10.5 Source_evidenceePCR920WS150 Sequence/Annotation Release
Chunk_score Abs_score815
Max_abs_score815F30A10.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94868759488056
Overlaps_transcript F30A10.5.2 Source_evidenceePCR918WS150 Sequence/Annotation Release
F30A10.5.1 Source_evidenceePCR920WS150 Sequence/Annotation Release
WB_DNA_textsjj_F30A10.51182gagatttgccggaagaacaacagtatttgattccttggcaagatttccaaaagctccaacatattgctctgcaacggtcaatccagcagcatttgcacctccatctttctcaagagccaatgcaatacgttcaatagctttggcacgagattcggctttaaggattactgcttctgcttctccctttgctacattgatacgttcggcttgaacagcctcagacgccaaaatagctgatttcttgtctccttcggccctggaaatgtttaaatttagaatatttttacaactctcacgatgttactgaatgaaatgtgtaattggaaaaatattatacctattaatggcagcttctctgattccttctgattccaaaatcgcggctcttttctttctctcagcttcaacttgcatttgcatagcttcttgaatttttgatggcatctgcatatctctgatttcgtatcgcatacattgaattccccaaggtgctgatgctttgttgattgcaaatacaatattttcattgagcaattccctctccttgaatactgtatccaaattgatttttccaacttcacttctcatcgttgtctgcgctaattgagttactgcgaattctgggtcatcgactccgtacgatgcctgcaatttacaaagaagtgttatttttcaattacaggcgaatcaaaaaacaggcgtcacatgccttgtagggatcgaaaacacgcaaataaagaactccgtcgagcctgagttgtacattgtcaattgtaatggctccttgctcaggaatctcaattgcaatttcacgaagattttgaacgaatttgattttatcaatgataggcaataagaagttgagtccctgaaaaagttggtttattaattaccttttaggaaatgttaccggttcaagaatcttgtagaactttcccattctttctacaacccacgcttcttgctgtggaacaaaattgatgacagtattatgtgcagcatgggcctgtcgtgatgatgtcacagctaatgggagcgttgaacttctaaataatataattgcccccctcacaataatttaatttatcggcctaccttagaagagctgacgaattcattaaaagtcgattagttagcgccattttctgtaaaatcatttttaatgatgcaatgcaatttcga