Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30A10.8   

sjj_F30A10.8 RNAi JA:F30A10.8
Simmer:F30A10.8:Screen_A
Simmer:F30A10.8:Screen_B
PCR_productsjj_F30A10.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F30A10.8a Source_evidenceePCR778WS150 Sequence/Annotation Release
F30A10.8b Source_evidenceePCR797WS150 Sequence/Annotation Release
Overlaps_Gene F30A10.8 Source_evidenceePCR797WS150 Sequence/Annotation Release
Chunk_score Abs_score755
Max_abs_score755F30A10.8
Specificity_index0.822
Rel_score1
Map_statusBest_ePCRI95036869504740
F30A10.9 Source_evidenceePCR185WS150 Sequence/Annotation Release
Chunk_score Abs_score164
Specificity_index0.178
Rel_score0.217
Map_statusBottom50_percentile_ePCRI95036869504740
Overlaps_transcript F30A10.8b Source_evidenceePCR797WS150 Sequence/Annotation Release
F30A10.8a Source_evidenceePCR778WS150 Sequence/Annotation Release
F30A10.9 Source_evidenceePCR185WS150 Sequence/Annotation Release
WB_DNA_textsjj_F30A10.81055catatgtggcaagagctggaatagatgcagatgcagaaggtagaattctagaaatgagaagtccatcaggaaggtattccctagcaatgagatgttcaagtagtgaagaagcagatggatggtttgaagctttacatgcctgtaccacgtgtcttctgactcaggcactggctcaagtcaatataatgctcggtaacaacccccaagtgagacatatgggttggattgcagaacaagtatcagaaaatggaatttcaatgtggaaacctaaatttatgacgcttacgaatagtgagatcttgttctatgaagctgttccacagctgaaagcagaatgggcagagccaagactagtacgtcctctggtggcaacaagagtcgttcagacaagttctcgaactgcgccagtaattaaaggtctcactgatgtgatctctttccgtatgagaactggaactcaacaaggtgttcggacacatacgatccgggtagaaactcatgcagaactggcacgatgggttcgtgcagtagtgatcggtggatatgaagcatgtctttctacatctcaagtctctgctccttgtctttggcgaggcgaatcatgcgaactaatagttaatctagacaatggaatatcattactttcgtcgactggagaggtgagctcattggaataatttagcaataagaaagtgataaacgttttctagattaaaacaaagatttataacatttagagaagctacattttcttaaagcttacaattcaggtactgtggcaacattcgtttgaaacgattcgcgccaccggcgatgatggtggtcgttttctctgggtcgattttggaccaccacatggtgaacaggtaaaaatggattttattttaaccttaatttcatacttatagaaaaaaaacggattttttttgtgtaaagtttttgaataaaaaaaaggataggcaacaaaacaataaaagcagatcaacaagtaatattcaaaacaaaagaagcataaatgaatgaaaaatttaggaattggatttgctaaattccgc